Labshake search
Citations for Agilent :
4201 - 4250 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Mutations in Vκ1 SP were performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) with the respective primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA integrity was measured with the RNA 600 pico Kit on a Bioanalyser (Agilent), 10 ng RNA with a RIN>6 was used for library preparation with the NuGen Ovation FFPE library system kit and mouse lnDA-C primers ...
-
bioRxiv - Pathology 2021Quote: ... Clone libraries were created using Strategene’s cloning kit (Agilent Technologies, Santa Clara, CA, USA) as per manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Integrity and concentration of RNA was checked using Bioanalyzer 2100 RNA Nano kit (Agilent), following standard protocols ...
-
bioRxiv - Microbiology 2020Quote: ... All point mutations were made using Site Directed Mutagenesis QuikChange II Kit (Agilent; 200524).
-
bioRxiv - Molecular Biology 2020Quote: ... The purified final library was validated with a TapeStation D1000 kit (Agilent, 5067-5582). The libraries were sequenced at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Genomics 2021Quote: ... and library size was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Reactions were sequenced on an Illumina NextSeq 500 using the 300-cycle High Output v2 Kit or NovaSeq 6000 using the SP 300-cycle v1 kit.
-
bioRxiv - Pathology 2019Quote: ... and then for an additional 30 minutes with the alkaline phosphatase EnVision kit (DakoCytomation). The second reaction was detected by means of a Vector blue alkaline phosphatase substrate kit (Vector Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for fragment size distribution using the BioAnalyzer 2100 High Sensitivity DNA Kit (Agilent). The fragment size distribution is used to determine how to make the cDNA into a sequencing library ...
-
bioRxiv - Immunology 2021Quote: ... and DNA fragment size was assessed using the High Sensitivity DNA BioAnalyzer kit (Agilent). cDNA concentrations were normalised and 0.125 ng of each cDNA was used in a quarter volume of a Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The quality of the total RNA was assessed using the RNA Nano Kit (Agilent). Poly-A selection was conducted on the total RNA using the PrepX PolyA mRNA Isolation Kit (Takara) ...
-
bioRxiv - Cancer Biology 2019Quote: ... All point mutants were generated by using the QuickChange site-directed mutagenesis kit (Stratagene),
-
bioRxiv - Immunology 2019Quote: ... Point mutations were generated using the QuickChange II site-directed mutagenesis kit (Agilent, 200523) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The intact cellular oxygen consumption rate (OCR) assay kit was purchased from Seahorse Bioscience. Horseradish peroxidase (HRP)-conjugated ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning of pCAGGS-VP3026A29S was performed with the multi-site directed mutagenesis kit (Agilent) according to the manufacture’s recommendations ...
-
bioRxiv - Plant Biology 2019Quote: ... and quality was assessed with the Agilent 6000 Nano Kit (Agilent, Santa Clara, California). Strand-specific library construction and paired-end RNA sequencing were done by Novogene (Chula Vista ...
-
bioRxiv - Genetics 2021Quote: ... Mutations were made in the CREAX reporter using the Quickchange II Kit (Stratagene, 200518). Details of the mutations are shown in supplementary table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The VPS41 mutant variants were made using the QuickChange Site-Directed Mutagenesis kit (Agilent) using the primers 5’-CAGCTTGTTGTACTTCCGTATGTAAAGGAGA and 5’- TCTCCTTTACATACGGAAGTACAACAAGCTG to generate GFP-VPS41S285P and 5’- GTTTATCTTCTGAGCTGAATGGGTTAATAGCC and 5’-GGCTATTACCCATTCAGCTCAGAAGATAAAC to generate GFP-VPS41R662* ...
-
bioRxiv - Biochemistry 2020Quote: Mutants of StSOR were constructed with a QuikChange site-directed mutagenesis kit (Agilent Technologies) using the following and complementary oligonucleotides ...
-
bioRxiv - Biochemistry 2021Quote: ... This was corrected by site-directed mutagenesis (SDM) using the QuikChange Lightening kit (Agilent), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA TseV2 and pBRA TseV3 plasmids as templates ...
-
bioRxiv - Cell Biology 2020Quote: ... and fragmented cDNA integrity was confirmed using the Agilent RNA 6000 Nano Kit (Agilent) and 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Neuroscience 2021Quote: ... Ric S73N and Q117L mutants were generated using the QuikChange II mutagenesis kit (Stratagene). YFP- and CFP-dDAT and Ric constructs were generated by subcloning into pEYFP-C1 and pECFP-C1 vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... We used the Fragment Analyzer dsDNA 920 Reagent Kit (Agilent Technologies, Santa Clara, CA) to perform the automated gel electrophoresis analysis ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutation A577I was introduced using QuikChange Lightning Site- Directed Mutagenesis Kit (Agilent Technologies). The constructs were cloned into a pET28b vector (Novagen ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations were introduced into bovine rhodopsin using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Point (Site) mutations of SOD2 were generated by QuikChange Site-Directed Mutagenesis kit (Stratagene). Both WT SOD2 and SOD2 mutant plasmids were transfected into ZF4 cells using Lipofectamine 3000 Transfection Reagent (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... or 229 (A229C) using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The mutated constructs were purified as described above ...
-
bioRxiv - Genomics 2021Quote: ... RNA integrity and quantity were finally measured using RNA Nano 6000 Assay Kit (Agilent) of the Bioanalyzer 2100 system ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PEAK3 A436E mutant was generated with the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The pCDNA3.1-V5-PTK2B (PYK2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were tested using an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Samples with an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations were created using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and pBRA SP-Tae5STM (STM14_0336 ...
-
bioRxiv - Microbiology 2019Quote: ... and TEXEL point mutations were accomplished similarly with Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Agilent Bioanalyzer with Agilent RNA 6000 Nano Kit (Agilent Technologies, Palo Alto, CA, USA) was used as per manufacturer’s guidelines to assess the integrity of RNA samples ...
-
bioRxiv - Immunology 2020Quote: ... and RNA integrity was evaluated with the Bioanalyzer RNA pico kit TapeStation (Agilent Technologies). Two hundred nanograms of total RNA was subsequently processed to generate RNA-seq libraries using NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA labeling was performed with the two color ‘Quick Amp Labeling Kit’ (Agilent genomics) using a 1:5 mixture of ‘FullSpectrum MultiStart Primer’ (Systembio) ...
-
bioRxiv - Immunology 2020Quote: ... We used the Seahorse XF Cell Mito Stress Test Kit (103015-100, Seahorse Bioscience) for the OCR assay ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was evaluated with an Agilent 2100 Bioanalyzer RNA pico kit (Agilent Technologies) prior to sequencing library preparation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and quantity and quality were verified using RNA 6000 Nano Kit (Agilent – 5067-1511) and an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2020Quote: ... and 2) size distribution using the High Sensitivity DNA BioAnalyzer kit (Agilent, 5067-4626). Libraries were constructed using the Nextera XT library Prep kit (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genomics 2021Quote: ... Library quality and size were assessed using a Bioanalyzer High Sensitivity DNA kit (Agilent). Libraries were run on HiSeq 4000 and NovaSeq6000 in 150 bp × 2 paired-end mode (Illumina ® ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA library was constructed using the SureSelect Low Input library prep kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified using a BioAnalyser high sensitivity DNA kit (Agilent, Cat#5067-4626) and a Qubit high-sensitivity dsDNA kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA quality was assessed using an RNA 6000 Pico kit (Agilent, 5067-1513) on a Bioanalyzer (Agilent G2939A).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quality-accessed with an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) with RNA integrity number above 9 for library construction ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies) in a BioAnalyzer instrument (Agilent) ...