Labshake search
Citations for Agilent :
4151 - 4200 of 8383 citations for Human Uromodulin Like 1 UMODL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RIN score was determined using a Bioanalyzer RNA 6000 Nano kit (Agilent, cat.no 5067-1511) in combination with the Agilent Bioanalyzer software ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Neuroscience 2023Quote: ... and H486R) were then introduced into this construct by QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using the corresponding primers (Primer List below ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... Quality of the RNA extraction was assessed using the 2100 Bioanalyzer (Agilent, RNA 6000 Nano Kit) and selecting samples with a RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed recombinant RlmI mutations using a QuikChange Site-Directed Mutagenesis Kit (#200518, Agilent Technologies, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7,7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... TFRC or 4-HNE was detected by using a Dako EnVision FLEX kit (Dako, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity number (RIN) was determined with Agilent RNA 6000 Nano Kit (Agilent, Cat. # 5067-1511) for quality check and all samples were above 8.5.
-
bioRxiv - Biochemistry 2024Quote: ... Mutations were introduced to the p38 expression construct using the QuikChange site-directed mutagenesis kit (Agilent). pCDFDuet-MKK6-EE was a gift from Kevin Janes (Addgene plasmid # 82718 ...
-
bioRxiv - Immunology 2024Quote: ... OCRs and ECARs were measured using Seahorse XF Cell Mito Stress Test Kit (103015-100, Agilent) and Seahorse XF Glycolysis Stress Test Kit (103020-100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated by following the microprep RNA isolation protocol and kit by Agilent (CAT#: 400805). RNA concentration after elution was calculated using a nanodrop in ng/µL of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Immunology 2024Quote: ... Total RNA size distribution was determined by RNA 6000 Pico Kit for 2100 Bioanalyzer systems (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quality of DNA samples was analysed using the high sensitivity DNA kit (Agilent 5067-4626) in Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta samples was assessed by Agilent Bioanalyzer 2100 (Fig. S1C) with the Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511). Then total RNA (500 ng per sample ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and DNA quality was verified using a Bioanalyzer 2100 with high-sensitivity DNA kits (Agilent, Japan). Short-inserts of 150-bp paired-end libraries were prepared for each individual using a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The construct cpSRP54(Q185R) was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) with pETDuet1™-cpSRP54 (Bals et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and the size was determined using the TapeStation 4200 with a High Sensitivity D1000 kit (Agilent). All libraries were mixed into a single tube with equal molarity ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Neuroscience 2024Quote: RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥8.7 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fixed cells were further incubated overnight in 1% NHS in TBSTx with rabbit anti-GFAP (diluted 1:500; Dako-Agilent, Santa Clara, CA, USA), rabbit anti-S100B (1:400 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fixed cells were further incubated overnight in 1% NHS in TBSTx with rabbit anti-GFAP (diluted 1:500; Dako-Agilent, Santa Clara, CA, USA), rabbit anti-S100B (1:400 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Neuroscience 2020Quote: ... a monoclonal anti-Aβ17–24 antibody (4G8, Additional file 1, Table S1) was subsequently combined with a polyclonal anti-GFAP (DAKO, Additional file 1, Table S1) as described previously (43) ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... Subunits were diluted 1:500 or 1:1000 in nuclease-free ultrapure water and OD 260nm was measured (Agilent Cary 60 UV/VIS spectrophotometer). Subunit concentrations were calculated as described previously such that 1 A260 unit corresponds to 25 pmol of 60S and 50 pmol of 40S respectively64 ...
-
bioRxiv - Genomics 2022Quote: ... 1 μL was quantified with a Qubit Fluorometer while another 1 μL aliquot was run on the BioAnalyzer 2100 (Agilent Technologies, Santa Clara, CA) to check the library quality and determine the weighted average fragment size ...
-
bioRxiv - Cell Biology 2023Quote: The following primary antibodies and concentrations were used in this study: rabbit anti-GFAP (DAKO, Agilent, clone Z0334; IF 1:500, WB 1:10,000), mouse anti-GFAP (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... blots were washed before adding the secondary antibodies (Polyclonal Swine Anti-Rabbit Immunoglobulins/HRP (Dako p0399; 1:5000 in 1% BSA and TBS-T) and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447 ...
-
bioRxiv - Microbiology 2021Quote: ... coli XL−1 Blue cells (Agilent Technologies, Santa Clara, CA) were transformed with assembled plasmids according to the provider’s instructions and stored at −80 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, California), rabbit anti-S100β (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used include anti-PCNA (Dako#M0879, 1:800), anti-Mef2c (Santa Cruz #SC313 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Swine Anti-Rabbit Ig/HRP (1:5,000, #P0217, Dako) as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... or monoclonal rabbit anti-glucagon (dilution 1:100, A0565, Dako) for 1h ...
-
bioRxiv - Neuroscience 2019Quote: ... the avidin-biotin-peroxidase complex (1:300; Dako, Glostrup, Denmark) was applied for 1 h at room temperature ...