Labshake search
Citations for Agilent :
4101 - 4150 of 8383 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... Deletion and point mutations were generated by using the QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s guidelines.
-
bioRxiv - Cancer Biology 2023Quote: ... purified DNA from 27 mice with the Sureprint G3 mouse CGH 244K microarray kit (Agilent Technologies), as previously described11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and size-distribution of DNA fragments was visualized with an Agilent DNA 1000 Kit (Agilent Technologies) and Agilent 2100 Bioanalyzer ...
-
bioRxiv - Physiology 2023Quote: ... MiRNAs were quantified using the smallRNA Analysis kit (DNF-470-0275) on a Fragment Analyzer (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control of obtained libraries was done using Agilent Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (PacBio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were tested for mycoplasma-free status using a Mycoplasma Assay Kit (Agilent Technologies, 302109).
-
bioRxiv - Microbiology 2023Quote: ... Mutagenesis of the different plasmids was achieved using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). All plasmids were freshly transformed into the appropriate strains before each of the experiments.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA (0.2 μg) was amplified using the Low Input Quick Amp Labeling Kit (Agilent Technologies) and labeled with Cy3 (CyDye ...
-
bioRxiv - Microbiology 2023Quote: ... and quality analysis were performed on a 2100 Bioanalyzer (Agilent Technologies, Agilent RNA 6000 Pico Kit). According to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and H486R) were then introduced into this construct by QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using the corresponding primers (Primer List below ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (PacBio ...
-
bioRxiv - Cell Biology 2023Quote: PARP14 point mutations were introduced through site-directed mutagenesis PCR using the QuickChange Lightning kit (Agilent) with primers described in Table 3 and confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... Additional rounds of site directed mutagenesis using the QuikChange XL II site directed mutagenesis kit (Agilent) were applied to create Ptch1 KR (ATT/LIN)-His ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library quality was assessed with a BioAnalyzer 2100 using the High Sensitivity DNA kit (Agilent Technologies). The libraries were quantified using the Kapa Library Quantification Kit Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Pathology 2023Quote: ... and its quality checked on a Bioanalyzer 2100 using RNA 6000 nano kit (Agilent Technologies, USA). Samples with RNA integrity number >=8.70 were selected.
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513), and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770 ...
-
bioRxiv - Biochemistry 2023Quote: ... Quality and quantity of total RNA was determined with DNF-471 RNA Kit −15 nt (Agilent) in the Fragment Analyzer 5300 (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We used a Femto Pulse system with an Ultra Sensitivity RNA kit (Agilent, #FP-1201-0275) to analyze quality control metrics.
-
bioRxiv - Cancer Biology 2022Quote: ... and S104T mutations were introduced by use of the QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) into the pHEBO-IRF4-HAtag expression construct according to the manufactureŕs recommendations and by use of primers indicated in Extended Data Table 6 ...
-
bioRxiv - Cell Biology 2023Quote: ... pShuttle constructs were subsequently transfected into HEK293A cells using the AdEasy adenoviral production kit (Agilent Technologies). The recombinant adenovirus was plaque purified ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial respiration was evaluated using the Seahorse XF Cell Mito Stress Test Kit (Agilent 103015-100) with the Seahorse XFe96 Analyzer (Agilent) ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations in WT hERG1a cDNA were made using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequence analysis ...
-
bioRxiv - Genomics 2022Quote: The average library length was assessed using the BioAnalyzer DNA High Sensitivity kit (Agilent, 5067-4626) on an Agilent 2100 BioAnalyzer ...
-
bioRxiv - Genomics 2023Quote: ... and its integrity was determined by the Bioanalyzer 2100 kit (Agilent Technologies, Santa Clara, CA, USA). RNA libraries were prepared with the Illumina TruSeq TM RNA Sample Preparation Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The MLS-TFEB mutant was generated using the Quikchange XL site-directed mutagenesis kit (200521, Agilent). The ΔMTS mutant was generated by cloning a truncated sequence of TFEB in the pcDNA 3.1 FLAG backbone (121416 ...
-
bioRxiv - Genomics 2023Quote: Eight library preparations were carried out using the SureSelect Methyl-Seq Target Enrichment kit (Agilent, G9651) following the manufacturer’s protocol (User guide ...
-
bioRxiv - Genomics 2023Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (Pacific Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sample quality assessment/size was validated by Bioanalyzer DNA-High Sensitivity Kit (Agilent Technologies, #5067-4626).
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy3-labeled cRNA was synthesized and purified using the Low Input Quick Amp Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quality was determined with a Bioanalyzer 2100 using an RNA 600 Nano kit (Agilent, USA). High quality of RNA was used to prepare RNA-Seq libraries with NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality was controlled using Agilent rna 6000 nano kit (5067-1511, Agilent, Santa Clara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Bioengineering 2023Quote: ... The resulting RNA-seq libraries’ quality and concentration were assessed using the D1000 DNA Kit (Agilent) on the TapeStation and a Qubit Fluorometer with the Qubit dsDNA HS Assay Kit (Life Technologies) ...
-
bioRxiv - Systems Biology 2024Quote: ... The DNA quality was assessed with an Agilent Bioanalyzer 2100 with a DNA 12000 Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... The integrity of the RNA was determined using the TapeStation High Sensitivity RNA kit (Agilent Technologies). 10 ng of total RNA has been used to prepare ribo-depleted RNA-seq libraries with these kits ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Cell Biology 2024Quote: ... size distribution was examined on the Fragment Analyzer with High Sensitivity NGS Fragment Analysis kit (Agilent), to ensure that the samples were the proper size ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HCK ORFs were performed using QuickChange Lightening Site-Directed Mutagenesis kit (Agilent Technologies, Les Ulis) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...