Labshake search
Citations for Agilent :
4051 - 4100 of 8613 citations for Testosterone ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Library fragment size was determined using the DNA 1000 Kit on the Agilent Bioanalyzer (Agilent Technologies). Libraries were quantified by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... IHC was performed with the DAKO EnVision+ System-HRP kit (cat# K4006, Agilent, Santa Clara, CA). Antigen retrieval was performed using Target Retrieval Solution for 20 minutes at > 90°C ...
-
bioRxiv - Cell Biology 2019Quote: ... All mutations in the plasmids were generated by site-directed mutagenesis using a QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA integrity was evaluated using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent) where samples with an RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2019Quote: ... The libraries were validated using the Agilent 2100 Bioanalyser and a high-sensitivity kit (Agilent Technologies) to ascertain the insert size ...
-
bioRxiv - Molecular Biology 2019Quote: ... The quality of purified libraries was assessed using a Bioanalyzer High-Sensitivity DNA Analysis kit (Agilent). For ATAC-seq ...
-
bioRxiv - Plant Biology 2020Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The RNA-seq libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Pathology 2021Quote: ... Asic2b N416A and Asic2b N443A mutants were generated using Quickchange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... site-directed mutagenesis was carried out with the Quick Change II Site-directed mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we performed DNA shuffling75 followed by error-prone PCR (GeneMorph II Random Mutagenesis Kit, Agilent Technologies). The DNA shuffled and error-prone PCRed library is hereafter referred to as the “Shuffled Library.”
-
bioRxiv - Microbiology 2020Quote: ... purified (Agencourt® AMPure® XP Beads) and quality-checked (High Sensitivity DNA Kit, Agilent Technologies). The final library was quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Mutations within the A1R were made using the QuikChange Lightening Site-Directed Mutagenesis Kit (Agilent Technologies) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: The avrE-yy mutation was made using the QuickChange II site-directed mutagenesis kit (Agilent Technologies). pENTR/D-TOPO:avrE was used as a template for quick change PCR ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA integrity was verified with Agilent RNA 6000 Nano kit on the 2100 Bioanalyzer (Agilent Technologies) or HS RNA Kit (15 nt ...
-
bioRxiv - Cell Biology 2020Quote: ... This clone was subsequently used for mutagenesis using the QuickChange Ligthning site-directed mutagenesis kit (Agilent). The putative weak NLS motif GLVMKRFRLS detected in the C-terminal domain of dTBCE was mutated into GLVMAAFALS to generate pENTR-dTBCEmutNLS ...
-
bioRxiv - Molecular Biology 2020Quote: ... an AfeI site was introduced by site-directed mutagenesis using the QuikChange II XL kit (Agilent) and oligos RU-O-22971 and RU-O-22972 ...
-
bioRxiv - Genomics 2020Quote: ... and quantified using an Agilent Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA). Libraries were pooled at equimolar concentrations into sixteen pools of six prior to probe hybridization to targeted capture probes following the Arbor Biosciences myProbes protocol v 3.0.1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the Agilent 2100 Bioanalyzer system and Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511) were used to measure the RNA integrity number for each sample ...
-
bioRxiv - Genomics 2021Quote: ... the samples were analyzed with the Agilent RNA 600 pico kit on the Bioanalyzer platform (Agilent). Furthermore ...
-
bioRxiv - Plant Biology 2021Quote: ... site directed mutagenesis was performed with QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, USA) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The ΔK210 mutation was introduced into troponin-T using a QuickChange Site-Directed Mutagenesis Kit (Agilent) and verified by sequencing ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Cancer Biology 2019Quote: Wobble mutant cell lines were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c ...
-
bioRxiv - Genomics 2021Quote: ... and quality was checked using the Agilent Bioanalyzer 2100 High Sensitivity DNA Kit (Agilent, Amstelveen, Netherlands). The genomic paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... Library quality was assessed using Agilent High Sensitivity DNA Kit and the 2100 Bioanalyzer instrument (Agilent). Libraries were then normalized to 5nM and pooled in equimolar concentrations ...
-
bioRxiv - Genetics 2020Quote: ... and p.I528V) were introduced by using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). NT5C2 recombinant protein production and purification were performed using previously described methods [28] ...
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Genetics 2021Quote: ... and quality controlled using an Agilent RNA 6000 Nano kit (Agilent, Cat No./ID 5067-1511) on 2100 Bioanalyzer system ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was quantitatively and qualitatively analyzed using the RNA Analysis Kit (Agilent Technologies DNF-489-0500). The RNA separation gel was mixed with an intercalating dye (AATI ...
-
bioRxiv - Physiology 2021Quote: ... RNA quality was assessed using the RNA Nano kit on an Agilent 2100 Bioanalyzer (Agilent Technologies), and RNA samples with an RNA integrity number > 8 were deemed suitable for RNA-seq experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The αSyn K96R variant was generated using the Quick-Change II site-directed mutagenesis kit (Stratagene) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality control and quantification of the libraries were performed using the Bioanalyzer DNA 1000 kit (Agilent) and the KAPA library quantification kit for Illumina (KAPA Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quality control and quantification assays were performed using High Sensitivity DNA kits on a Bioanalyzer (Agilent).
-
bioRxiv - Cell Biology 2020Quote: ... RNA-seq library preparation was done using the Agilent SureSelect Stranded kit (Agilent, Santa Clara, CA) as per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and only samples with RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial respiration was measured using Agilent’s Cell Mitochondrial Stress Test kit (Agilent Technologies, PN: 103015-100) and Seahorse XFe24 Analyzer ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutagenesis reactions were performed with QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) following the manufacturer protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... proSP-C BRICHOS D105N was obtained with QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, US), and the DNA sequence was confirmed (GATC Bioteq ...
-
bioRxiv - Biochemistry 2021Quote: ... and a serine at position 61 was replaced by a cysteine using the Quikchange kit (Agilent). GST-PHPLCδ1 was expressed in E ...
-
bioRxiv - Cell Biology 2021Quote: ... site-directed mutagenesis was performed on pCRII-mp-EGFP using a QuikChange Lightning mutagenesis kit (Agilent) to introduce two further mutations ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We generated mutant libraries of each gene via random mutagenesis with the Mutazyme II kit (Agilent), using 200ng of DNA template and eight cycles of mutagenic PCR ...
-
bioRxiv - Genetics 2020Quote: ... Variants in SATB1 and SATB2 were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). The primers used for site-directed mutagenesis are listed in Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... MAP2c phosphomimetic mutant S426E was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) and mutagenized primers (Table S5) ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA integrity was assessed using an Agilent Bioanalyzer (Agilent RNA 6000 pico Kit 5067-1513) and the RIN and DV200 were calculated ...
-
bioRxiv - Bioengineering 2020Quote: RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ~1 μg of total RNA using NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library fragment size was determined using the DNA 1000 Kit on the Agilent Bioanalyzer (Agilent Technologies). Libraries were quantified by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 27 samples sequenced using the SureSelectXT kit (75 MB; Agilent Technologies, Santa Clara, CA, USA), and 104X and 102X for tumor and normal ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples validation was performed on a Bioanalyzer 2100 using High Sensitivity DNA analysis kit (both Agilent) and sequenced on a MiSeq (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were controlled for fragment size using the High Sensitivity DNA analysis kit (Agilent, 5067-4626) on an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... ECAR was detected using Seahorse XF Glycolysis Stress Test kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s handbook ...