Labshake search
Citations for Agilent :
3951 - 4000 of 4476 citations for Anti DAP Kinase 1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... Both systems contained a DB-VRX capillary column (20 m, 0.18 mm ID, 1 µm film; Agilent) and a 100 µL gastight syringe (G4513-80222 ...
-
bioRxiv - Genomics 2022Quote: ... into 1 mL 96 well plates and sealed with a silicone plate mat (Agilent, Santa Clara, CA). Aliquots of 12 samples from each row were combined into pools ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μl sample was injected into a gas chromatograph coupled to a mass spectrometer (GC-MS; Agilent) on a HP-5MS column (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1 μg total RNA template per reaction was used using High Capacity cDNA Reverse Transcription Kit (Agilent). RNAase-free water (total 4.2 μl) ...
-
bioRxiv - Microbiology 2021Quote: ... and the average library size (Supplementary Table 1) was determined using the Agilent 2100 Bioanalyzer (Agilent Technologies). The library was diluted (to 6.5 pM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 4sU-labeled RNA was quality-checked by running on a 2100 Bioanalyzer Instrument (Agilent).
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot of the sample (1:10 diluted) was injected in the column of LC-MS (Agilent). The LC had 50 mm x 2.1mm ...
-
bioRxiv - Molecular Biology 2020Quote: ... GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent), and adenovirus was packaged as described previously (49) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA integrity was assessed in 1% agarose gel electrophoresis or TapeStation RNA ScreenTape (Agilent Technology, CA, USA). During RNA isolation ...
-
bioRxiv - Biochemistry 2021Quote: ... The hybridized slides were washed using Gene Expression Wash Buffer 1 (Agilent Technologies, Part Number 5188-5325) and Gene Expression Wash Buffer 2 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Biophysics 2020Quote: ... The cHMM cDNA was cloned into the pShuttle-IRES-hrGFP-1 vector (Agilent Tech., Santa Clara, CA) and an AdcHMM-Flag virus was prepared and amplified for expression of cHMM protein in C2C12 cells [36] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and their integrity was assessed via 1% agarose gel electrophoresis or Bioanalyzer RNA 6000 Nano kit (Agilent). Library quantification ...
-
bioRxiv - Cancer Biology 2022Quote: Full-length human Plk3 (1-646 aa; accession number NM_004073) cloned into a pCMV-Tag2A vector (Stratagene) to construct a Flag-tagged expression plasmid was described previously (Li et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 uL In-Fusion reaction mix was transformed into commercial chemically competent Escherichia coli (XL10-Gold, Agilent). Colonies were manually picked into Lysogeny broth supplemented with 100 μg/mL ampicillin in a 96-well block the next day after transformation and incubated in a shaker (MaxQ 5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL gas sample of head space was withdrawn and injected into the gas chromatography (Agilent 7890B) utilizing a gas-tight syringe to measure ethylene concentration ...
-
bioRxiv - Genomics 2024Quote: ... DNA length was assessed by running 1 μl on a genomic screentape on the TapeStation 4200 (Agilent). DNA concentration was assessed using the dsDNA BR assay on a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg RNA was used to synthesise cDNA using the Multi-temp cDNA Synthesis kit (Agilent, #200436). The final reaction volume was made up to 1ml with nuclease free water and used for RT-qPCR analysis.
-
bioRxiv - Pathology 2023Quote: ... USA) and fragmentation analyzed by 1% agarose gel electrophoresis and High Sensitivity Bioanalyzer 2100 assay (Agilent Technologies).
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Biophysics 2021Quote: ... and endogenous peroxidase was blocked with 3% H2O2 in TBS for 5 min followed by incubation with anti-mouse EnVision+ labelled polymer (Agilent Technologies, Santa Clara, USA) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: 1×104 OE19 cells were reverse transfected with siRNAs and seeded into 96-well plates (Agilent, 102601-100). 24 hours post-transfection cells were treated with 500 nM lapatinib or vehicle control ...
-
bioRxiv - Microbiology 2019Quote: ... Japan) equipped with a 30 m × 0.25 mm DB-1 capillary gas chromatography column (Agilent Technologies, CA, USA). For analysis ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Immunology 2019Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 x 0.5 cm ...
-
bioRxiv - Immunology 2021Quote: ... MSP-142 and AMA-1 were biotinylated and tetramerized with streptavidin-PE (SA-PE; Agilent, Santa Clara, CA) as previously described.46 A decoy reagent to gate out the non-MSP-142 or AMA-1–specific B cells was constructed by conjugating SA-PE to DyLight 650 (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ∼20 nl/minute ...
-
bioRxiv - Plant Biology 2020Quote: ... The fragments were diluted to reach a concentration range of 1-10 ng/μL as required by Agilent High Sensitivity DNA kit ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h at room temperature and positive signals were visualized with the diaminobenzidine (DAB) substrate (Dako, #K3468).
-
bioRxiv - Microbiology 2022Quote: ... coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)]) (Stratagene) was used for general cloning and E ...
-
bioRxiv - Biophysics 2022Quote: ... HIV-1 GagG2A -EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Venus6 was a gift from Steven Vogel (76 ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1 h at room temperature and positive signals were visualized with the diaminobenzidine (DAB) substrate (Dako, #K3468). The following primary antibodies were used ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ~20 nl/min ...
-
bioRxiv - Neuroscience 2021Quote: ... we performed immunohistochemical stainings against glial fibrillary acidic protein (GFAP, rabbit-anit-GFAP, 1:500, Dako, Hamburg, Germany) counterstained with a Cy3-conjugated secondary antibody goat-anti-rabbit (1:200 ...
-
bioRxiv - Biochemistry 2020Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 × 0.5 cm ...
-
bioRxiv - Neuroscience 2019Quote: ... Cell nuclei were stained with Hoechst (1:10000) and the coverslips were mounted with DAKO fluoromount medium (Agilent). The primary antibodies were used ...