Labshake search
Citations for Agilent :
3951 - 4000 of 4126 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2022Quote: ... SARS-COV-2-Strunc variants were generated in house by site-directed mutagenesis (QuikChange Multi Site-Directed Mutagenesis Kit, Agilent) starting from synthetic DNA (Genscript) ...
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Jackson ImmunoResearch Laboratories and was used for Western blotting. Affinity-purified rabbit polyclonal anti-human lambda-light chain (cat. A019302-2) was purchased from Dako and was used for Western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... HCT-8 cells or HCT-8 AhR KO cells were plated at 2 x 104 cells per well in a 96-well Seahorse XF96 cell culture microplate (Agilent) and grown for ∼24h ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Microbiology 2023Quote: ... were prepared and stained with hematoxylin eosin (HE) for histological examination or subjected to immunohistological staining to detect SARS-CoV-2 antigen (performed in an autostainer; Agilent), using the horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Genomics 2024Quote: ... The high-molecular weight DNA sample was then sheared to a mean size of 20 kb with a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and the subsequent size distribution was assessed with an Agilent Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Plant Biology 2024Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2024Quote: ... SC/KD-miRNA-transduced MIN6 cells were cultured in 2 mM glucose and treated with a total RNA isolation mini kit (Agilent) and 1st strand synthesis kit (Origine) ...
-
bioRxiv - Biochemistry 2024Quote: ... The plates were then shaken for 2 minutes and luminescence was measured using the BioTek Cytation 5 cell imaging multimode reader (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... The final co-cultures were then incubated at 37°C in an automated spectrophotometer (Biotek Synergy 2, Agilent Technologies, USA) for 48 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... tissues were incubated with primary antibodies overnight (Iba1 (019-19741, FUJIFILM Wako Pure Chemical Corporation) or S100b (GA50461-2, Agilent)) ...
-
bioRxiv - Biochemistry 2019Quote: ... The mixtures of standards were dried under vacuum using a vacuum rotation evaporator (Extractor Plus®, Agilent, settings: 30°C, 4 h, 1000 rpm, VAQ).
-
bioRxiv - Microbiology 2020Quote: ... Sample quality control was assessed using a Qubit 4 Fluorometer (using Qubit™ dsDNA BR assay Kit) and Agilent 2200 TapeStation (using Agilent D5000 ScreenTape assay kit). Library construction and sequencing was undertaken at Novogene (Beijing ...
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell viability was assessed by measuring the absorbance at 570 nm wavelength using Epoch 2 microplate spectrophotometer (Agilent technologies. USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The single layer supernatant was pipetted into separate 2 mL screw cap amber-glass autosampler vials (Agilent Technologies, Cheadle, United Kingdom); being careful not to break up the solid pellet at the bottom of the tube ...
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Genomics 2019Quote: ... fragments with UMIs were generated using 200 ng starting material (purified by ethanol precipitation) in 2 cycles of PCR with Herculase II Fusion DNA Polymerase (Agilent Technologies) using an equimolar mixture of P023poolseqNN-primers (1 mM final concentration ...
-
bioRxiv - Developmental Biology 2019Quote: ... truncated and deletion versions of RAB13 3’UTR were generated by PCR using 0.3 μM sequence-specific primers (Extended Data Table 2) and Platinum Pfx DNA polymerase or using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) following the manufacturer’s instructions and introduced into the pcDNA3-HBB-24XMS2SL-MCS using the NheI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The RNA was then cross-linked to positively charged membranes using a UV-crosslinker (Stratagene UV Stratalinker 2400, 2×240 mJoules) and stained with methylene blue (SERVA ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...