Labshake search
Citations for Agilent :
351 - 400 of 1346 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... microglial lysosomes were stained using CD68 (mouse anti-human monoclonal primary antibody, Dako M0876,1:100 ...
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with polyclonal antibodies against human kappa light chains (Dako, A0192) and by HRP-conjugated protein A (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-human CD20 clone L26 Dako Omnis (Agilent, Santa Clara, CA, USA). The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L ...
-
bioRxiv - Cancer Biology 2022Quote: ... Subsequently libraries were hybridized to specific SureSelect XT Human capture libraries (Agilent Technologies) and sequenced in paired-end mode (2×75 bp ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Pathology 2020Quote: ... A polyclonal rabbit anti-human CD3 antibody (1:200; Agilent Technologies Inc, CA) was applied for 15 min and used with Leica Polymer Refine Detection kit to complete the staining.
-
bioRxiv - Pathology 2021Quote: ... Whole human genome oligonucleotide microarray (44K oligonucleotide DNA microarray, Agilent Technologies, Tokyo, Japan) was used for microarray experiments ...
-
bioRxiv - Genomics 2019Quote: ... and mouse monoclonal anti-human CD8 (DAKO, clone C8/144B, dilution 1:25) at 1 hour RT ...
-
bioRxiv - Physiology 2021Quote: ... Anti-human CD68 (mouse monoclonal IgG3, clone PG-M1, Dako, dilution 1/100) and anti-human IL-1β (rabbit polyclonal antibody ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing were generated using SureSelect Human All Exon 50Mb Kit (Agilent Technologies) coupled with Illumina HiSeq sequencing system (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were generated using Agilent SureSelect Human All Exon kit (Agilent Technologies) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample (experimental details provided in the Supplementary Data).
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies, Glostrup, Denmark) primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... gene expression analysis was carried out by Agilent Whole Human 44K Genome Oligo Array (G4112A, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... and libraries were enriched with exome baits (Agilent SureSelect Human All Exon V6). Separate tumor sections were placed on 10X Visium arrays (slide serial number ...
-
bioRxiv - Immunology 2023Quote: ... and as secondary antibody we used anti-human IgG HRP antibody (Agilent P0214) diluted 1:8,000 in PBS + 1% SM ...
-
bioRxiv - Genetics 2024Quote: ... A SureSelect Human All Exon V6+UTR r2 core design (91 Mb, Agilent) was used for exon capture ...
-
bioRxiv - Genomics 2024Quote: ... spiked into a background of human reference RNA (Agilent Technologies, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... human stem cell-derived ECs were cultured in the xCELLigence RTCA SP (Agilent) device and treated with cARLA or control medium exactly as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant transfer vector was linearized by PmeI and transformed into electro-competent E.coli strain BJ5183-AD-1 (Stratagene, Cat. No. 200157-11) for in vivo recombination with pAdEasy vector ...
-
bioRxiv - Microbiology 2023Quote: ... Sequence encoding the 96-120 NS2B residues was removed from recombinant pTrcHisA plasmid by PCR based site directed mutagenesis [40] using Pfu ultra II fusion HS DNA polymerase (Agilent, Santa Clara, USA) to generate recombinant plasmids expressing N-terminal hexahistidine tag fused active NS2B(H)-NS3(pro ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Developmental Biology 2019Quote: ... elegans PGL-3 NtDD wild type and mutant recombinant protein were determined by conducting SEC-MALS experiments using Agilent Technologies 1260 LC HPLS system (Agilent Technologies, Santa Clara, CA) equipped with Dawn® Heleos™II 18-angle MALS light scattering detector ...
-
bioRxiv - Biochemistry 2022Quote: ... Product titer was analyzed offline from spent media daily by protein A chromatography on the Agilent Bioinert 1260 HPLC system using a Bio-Monolith Recombinant Protein A column (Agilent Technologies, Santa Clara, CA). An XCell™ ATF system (Repligen ...
-
bioRxiv - Biochemistry 2023Quote: Titer analysis of spent medium was analyzed offline daily by Protein A chromatography on an Agilent Bioinert 1260 HPLC system using a Bio-Monolith Recombinant Protein A column (Agilent Technologies, Santa Clara, CA) as well as with the BLItz biolayer interferometer system (ForteBio ...
-
bioRxiv - Immunology 2021Quote: ... followed by washing and horseradish peroxidase-conjugated rabbit anti-human IgG (1:3,000; Dako). Bound antibodies were detected by adding TMB PLUS2 (Eco-Tek) ...
-
bioRxiv - Genomics 2020Quote: ... LECs were additionally co-stained with mouse anti-human CD31 antibody (clone JC70A, Dako) at a dilution of 1:50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and processed by SureSelectXT Human All Exon V5 (Agilent Technologies, Santa Clara, CA, USA). Captured DNA was sequenced using HiSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: The one-color microarray Human miRNA Microarray Kit (V2) design ID 029297 from Agilent Technologies was used to measure miRNA expression for 425 tumors of the Oslo2 cohort using 100 ng total RNA as input ...