Labshake search
Citations for Agilent :
351 - 400 of 5373 citations for Rat Insulin INS ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... An Agilent High Sensitivity DNA Kit (Agilent) was used to assess library quality on an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2100 Bioanalyzer DNA 1000 kit (Agilent) was used to determine the medium peak size ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA1000 assay kit (Agilent, 5067-1505) respectively ...
-
bioRxiv - Immunology 2023Quote: ... or Bioanalyzer RNA 6000 pico kit (Agilent) and samples were found to have RIN values above 7 ...
-
bioRxiv - Plant Biology 2023Quote: ... using the RNA 6000 Nano Kit (Agilent). Poly-A enriched libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... a QuickChange site-directed mutagenesis kit (Stratagene) was used for generating the NMA1982 mutants D71A ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified by Agilent RNA 6000 Pico Kit (Agilent #5067-1513). RNA from blood was extracted as per the protocol recommended by the manufacturer (PureLink™ Total RNA Blood Kit #K156001).
-
bioRxiv - Genetics 2023Quote: ... The reagent kit SureSelectXT HSQ (Agilent, G9611A) was used according to the manufacturer’s manual ...
-
bioRxiv - Neuroscience 2023Quote: ... with the High Sensitivity DNA Kit (Agilent) according to manufacturer’s instructions and the 10X Genomics protocols ...
-
bioRxiv - Biophysics 2023Quote: ... PCR site directed mutagenesis kit (Agilent Technologies) was used according to the instruction manual for mutagenesis PCR.
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies) and Qubit DNA HS assay kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... with an RNA 6,000 Nano Kit (Agilent). RNA sequencing libraries were made using the TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... using Dako animal research kit (Dako #A3954) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... with the DNA High Sensitivity Kit (Agilent). The DNA concentration in the samples was quantified using the Qubit 2.0 instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... using High Sensitivity DNA kit (Agilent Technologies). Libraries were sequenced (Read1 ...
-
bioRxiv - Microbiology 2023Quote: ... and an RNA Pico Kit (Agilent Technologies), which confirmed that no severe RNA degradation was observed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The quality of libraires was assessed by Agilent DNA 1000 kit (Agilent, Cat# 5067-1504)) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cell Biology 2023Quote: ... and a High sensitivity DNA kit (Agilent). Libraries were quantified using Colibri Library Quantification kit (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and a High sensitivity DNA kit (Agilent). Libraries were quantified using Collibri Library Quantification kit (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The QuikChange site-directed mutagenesis Kit (Stratagene) was used to generate the Aq ...
-
bioRxiv - Physiology 2024Quote: ... using the RNA 6000 Nano Kit (Agilent). For RNA-Seq and qPCR analysis ...
-
bioRxiv - Immunology 2023Quote: ... Cell Mito Stress Test Kit (Agilent Technologies). Final inhibitor concentrations in the wells were 1.5 μM oligomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... and the High sensitivity DNA kit (Agilent), quantified using Collibri Library Quantification kit (Invitrogen).and thereafter sequenced in 75bp paired-end reads on an Illumina NextSeq550 instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2100 BioAnalyzer D1000 kit (Agilent 50671504) and Illumina MiSeq Nano v2 QC.
-
bioRxiv - Microbiology 2024Quote: ... using the High Sensitivity DNA Kit (Agilent). The total DNA for each sample was fragmented using the ultrasonicator Covaris S220 (Covaris Inc.) ...
-
bioRxiv - Immunology 2024Quote: ... the Mito Stress Test kit from Agilent was used to probe different aspects of mitochondrial function with respiratory chain inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent) or TapeStation with the Agilent RNA ScreenTape assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent). Samples for sequencing were subject to rRNA depletion and library preparation by Illumina Truseq kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA quality control measurement was done using the High Sensitivity RNA Kit and RNA 6000 Nano Kit (Agilent Technologies). Ovation® RNA-Seq System V2 (NuGEN ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2019Quote: ... The RNA was DNase treated using Turbo DNA free kit according to manufacturer’s protocol (Thermo Fischer scientific) for making cDNA using Accuscript hi-fidelity cDNA synthesis kit (Agilent). The qRT-PCR was set up using brilliant III ultra-fast SYBRgreen qPCR master mix in Mx3005P qPCR system Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2019Quote: All libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and checked for fragment size using the TapeStation D1000 kit (Agilent). The libraries were pooled in equimolar concentration for a total pooled concentration of 2nM ...