Labshake search
Citations for Agilent :
351 - 400 of 6408 citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Bioluminescence was read using a BioTek Synergy Neo2 plate reader (Agilent, UK) or a CLARIOstar Plus plate reader (BMG LabTech ...
-
bioRxiv - Biochemistry 2022Quote: ... H2O in the sensor plate was replaced with Seahorse XF Calibrant (Agilent) and cells were washed with HBSS and incubated in Seahorse media (Seahorse XF assay medium (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was incubated and developed with streptavidin-HRP (DAKO P039701-2) and TMB substrate (BD OptEIA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... for incubation in a Cytation 1 multi-mode plate reader (Agilent BioTek). Plate lids were treated with 10% Triton X-100 in ethanol to prevent fogging (73) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The signals were read with a plate reader (Agilent, Santa Clara, CA).
-
bioRxiv - Microbiology 2023Quote: ... coated Agilent Seahorse XFp cell culture mini plate (Agilent, Santa Clara, CA). The plates were centrifuged at 200g for 1 min with minimum deceleration ...
-
bioRxiv - Microbiology 2023Quote: ... plates were washed with 1x PBS using a microplate washer (405LS, Agilent). Cells were then fixed with 4% Formaldehyde and stained with DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence values were read on a BioTek Synergy H1 plate reader (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was read on a microplate reader (Cytation5 spectrophotometer, Biotek, Agilent) upon setting fluorescence at Ex/Em = 485/535 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM pyruvate and seeded in a XF plate (Agilent, 103793-100) coated with poly-L-lysine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA concentrations were determined on a Varian Eclipse fluorescence plate reader (Agilent, USA) using the Quant-iTTM PicoGreen® dsDNA Assay Kit (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were adhered to each well of the Seahorse plate (Seahorse/Agilent, USA) using CellTak (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: ... the plate was loaded into the Seahorse XF96 Extracellular Flux Analyzer (Agilent Technologies). The following compounds were Injected during the assay ...
-
bioRxiv - Molecular Biology 2021Quote: ... Individual cells were collected in 384-well plates with ERCC spike-ins (Agilent), reverse transcription primers and dNTPs (both Promega) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The plates were placed into a BioTek BioSpa 8 Automated Incubator (Agilent Technologies) and read by brightfield and fluorescence imaging on a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... The plate is dried on a Positive Pressure Manifold (Agilent, Santa Clara, CA), placed above fresh round bottom 1 ml 96-well collection plate to elute samples using 750 µL of 5% ammonium hydroxide in 1:1 methanol/acetonitrile ...
-
bioRxiv - Genomics 2021Quote: ... HCC1806 cells were plated into XF96e cell culture plates (Seahorse Bioscience, North Billerica) with a density of 40,000 cells/well ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell plates were inserted in an XFe24 Seahorse Analyzer apparatus (#102238-100, Agilent), acutely challenged with 10 μM CGP-37157 or DMSO ...
-
bioRxiv - Immunology 2022Quote: ... or a BioTek Synergy NEO plate reader (Agilent Technologies, Santa Clara, CA, USA); VNT were reported as the 90% inhibitory concentration (IC90 ...
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Neuroscience 2023Quote: Sensory neurons were seeded into Seahorse cell plates (Agilent, Santa Clara, CA, USA) and cultivated for six weeks ...
-
bioRxiv - Microbiology 2023Quote: ... and OD600 readings were taken using a Synergy LX plate reader (Agilent BioTek).
-
bioRxiv - Microbiology 2023Quote: ... and OD600 readings were taken using a Synergy LX plate reader (Agilent BioTek).
-
bioRxiv - Cell Biology 2022Quote: ... DNA quantity was determined using a BioTek Synergy H1 plate reader (Agilent Technologies), and PCR reactions were performed using Acomys-specific primers for the target SrY ...
-
bioRxiv - Cell Biology 2023Quote: ... 15,000 cells/well were seeded in a 96-well E-plate (Agilent, 5232368001)47 containing gold microelectrodes fused to the bottom surface of the well plate ...
-
bioRxiv - Physiology 2023Quote: PAEC were plated in a Cell Tak-coated XF24 cell culture plate (Agilent) in XF assay media pH 7.4 (Agilent ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Mean optical density was read on a Synergy H1 plate reader (Agilent BioTek), and corticosterone concentrations were determined in ug/mL based on a standard curve.
-
bioRxiv - Microbiology 2024Quote: ... The 96-well plates were placed in Biotek Epoch 2 Microplate Spectrophotometer (Agilent). OD600 measurements were made for 24 hours in 20-minute intervals and the OD600 values were plotted in GraphPad Prism software.
-
bioRxiv - Systems Biology 2024Quote: ... All measurements were read with a BioTek Synergy HTX Multimode Plate Reader (Agilent). All samples from a single tissue-type were measured on the same plate ...
-
bioRxiv - Microbiology 2024Quote: ... and optical density measurements at 600nm in a plate reader (Epoch 2, Agilent) for 20h ...
-
bioRxiv - Neuroscience 2024Quote: Real-time oxygen consumption rate (OCR) was measured using XFe96 plate (Seahorse Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and monitored with a BioTek Synergy HTX plate reader (Agilent, Santa Clara, CA). Intrinsic fluorescence from TA analogs did not interfere with monitoring reaction progress by the increase in ThT fluorescence (λex = 440 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a skirted PCR plate to facilitate automation (Agilent Bravo liquid handling system). Library pools then underwent qPCR quantification and libraries were adjusted to a concentration of 2nM ...
-
bioRxiv - Immunology 2024Quote: ... CD14+ monocytes were seeded onto XFe24 cell culture plates (Seahorse Bioscience, Lexington, MA) with RPMI medium with 10% HS ...
-
bioRxiv - Microbiology 2024Quote: ... Luminescence was detected a BioTek Synergy Neo2 plate reader (Agilent, Santa Clara, CA). The amount of ATP was calculated and normalized to cell count.
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).