Labshake search
Citations for Agilent :
351 - 400 of 7112 citations for Mouse 14 3 3 protein sigma SFN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Neuroscience 2022Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: ... or humanized Renilla luciferase (5’-CCC CGA GCA ACG CAA AC-3’ and 5’-GCA CGT TCA TTT GCT TGC A-3’) and in 1x Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies). The reaction and fluorescence readout were performed in Rotor-Gene 6200 (Corbett Life Science ...
-
bioRxiv - Bioengineering 2019Quote: ... Removal of the native splice acceptor in the 3’ homologous arm of HDR templates was achieved via site-directed mutagenesis (Agilent Technologies, 200523).
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed in TBST (3 × 15 mins at RT) and then incubated with corresponding peroxidase-conjugated secondary antibodies (Dako, P0447, P0448) for 1h at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... was performed on 3-μm thick tissue sections using split signal FISH DNA probes for BCL2/18q21 (probe Y5407; DAKO A/S), BCL6/3q27 (probe Y5408 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were finally washed for 3 × 10min with PBS before mounting them on glass coverslips with Dako fluorescence conserving media (Dako, Hamburg, Germany).
-
bioRxiv - Cancer Biology 2020Quote: To construct RNA-seq libraries from C.elegans samples, we used an automated QuantSeq 3’mRNA-seq (Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Cell Biology 2020Quote: ... embryos were washed 3 times in PBV and transferred onto a glass microscope slide with DAKO mounting medium (Dako Inc., Carpinteria, California) and enclosed with a coverslip using a spacer (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... the sample quality was checked with both the Qubit 3 Fluorometer and the High Sensitivity D1000 ScreenTape assay (Agilent Technologies #5067-5584). The libraries were equimolarly pooled ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Thirty-six metabolites were from a list of potential biotransformation products directly derived from HGA and compiled using the Biotransformation Mass Defects application (Agilent; Appendix 3). This tool provides a list of potential metabolic biotransformation products covering both phase I (n=19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3 liver cancer specimens also underwent bulk-level WES using Agilent SureSelect Human All Exon v7 K it (Agilent, 5191-4005) and illumina NovaSeq 2 × 150 bp sequencing mode ...
-
bioRxiv - Biochemistry 2023Quote: Prior to LCMS analysis the TIMSTOF SCP was freshly tuned using the OTOF Control engineering software with an infusion of 3 μL/min of low-concentration tuning mix (Agilent, G1969-85000). Autotuning was performed for sensitivity and resolution tuning was manually checked ...
-
bioRxiv - Biochemistry 2023Quote: Prior to LCMS analysis the TIMSTOF SCP was freshly tuned using the OTOF Control engineering software with an infusion of 3 μL/min of low-concentration tuning mix (Agilent, G1969-85000). Autotuning was performed for sensitivity and resolution tuning was manually checked ...
-
bioRxiv - Systems Biology 2023Quote: ... Membranes were washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako, P0448/P0447) at room temperature for 1 h (1:2000 in 0.3% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent, 204495-100) containing the HB95 cross-linked beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... treated with 3% H2O2 to block endogenous peroxidase then incubated in a steamer for 30 minutes in Target Retrieval Solution (Dako, #S1699, #S2367) for antigen retrieval ...
-
bioRxiv - Cell Biology 2023Quote: ... TMEM24(ΔBS + 5S → E)-eGFP was generated using site-directed mutagenesis to remove a portion of the C-terminus of TMEM24(5S → E)-eGFP including the first 3 β-strands of the β-sheet band 4.1 interacting domain (Quik-Change II XL; Agilent Technologies).TMEM24(5S → E)-eGFP which has been previously described (Sun et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... Membranes were washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako, P0448/P0447) at room temperature for 1 h (1:2000 in 0.3% (w/v ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were permeabilized with 0.1% Triton x-100 (Fluka, 93426) and blocked with the blocking solution containing 3% Goat serum (Dako, Cat. no. X0907), 0,1% sodium azide (the healthcare business of Merck KGaA ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP ...
-
bioRxiv - Cell Biology 2019Quote: ... The anc-1 3’UTR RNAi construct was generated by PCR amplifying part of the 3’UTR-region of the anc-1 transcript using Paq5000™ DNA Polymerase (Agilent Technologies, 600682). The primer sequences are detailed in Table S2 ...
-
bioRxiv - Plant Biology 2020Quote: ... The sample components were separated on a C18 olumn (Hypersil GOLD C18; 4.6 mm × 100 mm; 3 µm particle size; Agilent, Santa Cruz, CA, USA). The column was eluted at 0.3 mL/min with a gradient from 95% solvent A (0.1% formic acid in water ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Microbiology 2021Quote: ... The extracts were acidified to pH 2 and additionally pre-treated with solid-phase extractions using Agilent Bond Elut-PPL 3 mL columns and diluted to 50 ppm (Agilent Technologies, DE, USA) following standard lab protocol29 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then further diluted in ultrapure water to a final 3% nitric acid concentration and analyzed by triple quadrupole inductively coupled plasma-mass spectrometry (Agilent 8800 ICP-QQQ). Copper concentrations were determined by using standard curves ...