Labshake search
Citations for Agilent :
351 - 400 of 5970 citations for Human Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... we used the i) Agilent SureSelectXT Human All Exon V6 (Agilent Technologies), ii ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C.
-
bioRxiv - Cancer Biology 2022Quote: The human CDK1 S39A mutation was introduced using Quickchange (Agilent, cat #600670) using specific primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The exons were captured using SureSelect XT2 Human All Exon V6 (Agilent), and sequenced by paired-end 75 bp sequencing on HiSeq4000 (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... GFAP was detected with polyclonal rabbit-anti human GFAP (1:500, Agilent) and donkey anti-rabbit IgG AF55 detection (1:500 ...
-
bioRxiv - Immunology 2019Quote: ... Sections were incubated with mouse anti-human CD68 (#M0814, Clone KP1, Dako) antibody (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-human PECAM-1 (CD31) (M0823, Agilent Dako, Santa Clara, CA), GAPDH mouse anti-human (10R-G109b ...
-
bioRxiv - Immunology 2020Quote: ... or rabbit anti-human IgA/HRP (Dako: cat. P0216, 1:5’000 dilution). Assays were developed by addition of 3,3’,5,5’-Tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2020Quote: ... Bound antibodies were detected using HRP-labelled rabbit anti–human IgG (Dako) or anti-hamster IgG and TMB (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: Immunohistochemistry on human (antigen retrieval by Target Retrieval Solution pH6.0 (DAKO #S1699)) and mouse fetal tissue was performed using Autostainer (Dako ...
-
bioRxiv - Genomics 2021Quote: ... MAQCA is the Quantitative PCR Human Reference Total RNA (#750500, Agilent technologies), extracted from cell lines representing different human tissues ...
-
bioRxiv - Immunology 2020Quote: ... Monoclonal mouse IgG1 anti-human CD32 (clone KB61) was purchased from Dako, Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The NCBI BioProject database accession number is PRJNA600674 ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The Gene Expression Omnibus accession number is PRJNA600674 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human ARRB2 cDNA was cloned into pCMV-3Tag-8 (Agilent Technologies). The plasmid contains three copies of a FLAG epitope tag fused in-frame to the 3’ end of the ARRB2 cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Whole-exome sequencing was performed using SureSelect Human All Exon V7 (Agilent) according to manufacturer’s protocol and sequenced on an Illumina NextSeq 500 (paired-end 150 bp reads) ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated with primary antibodies against human CD31 (1:50, JC70A, Dako), PDGFRβ (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... Microdeletions were identified by array-CGH (Human Sureprint 2×105K, Agilent technologies) and confirmed with semiquantitative PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary antibody was mouse anti-human Aβ (Dako #M0872; 1:400) and the secondary antibody was Vectastain ABC kit anti-mouse secondary antibody (Vector Laboratories #PK-4002 ...
-
bioRxiv - Physiology 2024Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then immunostained using an anti-human Ki-67 (Dako # M724001) antibody and nuclear DNA was stained using 4,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: 10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Genomics 2020Quote: ... Slides were additionally co-stained with rabbit anti-human vWF polyclonal antibody (Dako) at a dilution of 1:100 overnight at 4°C followed by donkey Alexa488-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...
-
bioRxiv - Cancer Biology 2020Quote: ... the following antibodies were used: anti-human Ki-67 (DAKO, clone Ki-67), anti-oestrogen receptor alpha (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The specific primary antibody polyclonal rabbit anti-human CD3 (Dako, #A4052, California, USA) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein-coding genes were captured using SureSelectXT Human All Exon V5 probes (Agilent) and sequenced on Illumina HiSeq 4000 using 100bp paired end read protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... these slides were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C to mark the nerve fibers ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... microglial lysosomes were stained using CD68 (mouse anti-human monoclonal primary antibody, Dako M0876,1:100 ...
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with polyclonal antibodies against human kappa light chains (Dako, A0192) and by HRP-conjugated protein A (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-human CD20 clone L26 Dako Omnis (Agilent, Santa Clara, CA, USA). The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L ...
-
bioRxiv - Cancer Biology 2022Quote: ... Subsequently libraries were hybridized to specific SureSelect XT Human capture libraries (Agilent Technologies) and sequenced in paired-end mode (2×75 bp ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Pathology 2020Quote: ... A polyclonal rabbit anti-human CD3 antibody (1:200; Agilent Technologies Inc, CA) was applied for 15 min and used with Leica Polymer Refine Detection kit to complete the staining.
-
bioRxiv - Pathology 2021Quote: ... Whole human genome oligonucleotide microarray (44K oligonucleotide DNA microarray, Agilent Technologies, Tokyo, Japan) was used for microarray experiments ...
-
bioRxiv - Genomics 2019Quote: ... and mouse monoclonal anti-human CD8 (DAKO, clone C8/144B, dilution 1:25) at 1 hour RT ...
-
bioRxiv - Physiology 2021Quote: ... Anti-human CD68 (mouse monoclonal IgG3, clone PG-M1, Dako, dilution 1/100) and anti-human IL-1β (rabbit polyclonal antibody ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37 °C ...