Labshake search
Citations for Agilent :
351 - 400 of 5703 citations for Cow Ataxin 10 ATXN10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and 2100 BioAnalyzer D1000 kit (Agilent 50671504) and Illumina MiSeq Nano v2 QC.
-
bioRxiv - Microbiology 2024Quote: ... using the High Sensitivity DNA Kit (Agilent). The total DNA for each sample was fragmented using the ultrasonicator Covaris S220 (Covaris Inc.) ...
-
bioRxiv - Immunology 2024Quote: ... the Mito Stress Test kit from Agilent was used to probe different aspects of mitochondrial function with respiratory chain inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent) or TapeStation with the Agilent RNA ScreenTape assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the RNA 6000 Nano kit (Agilent). Samples for sequencing were subject to rRNA depletion and library preparation by Illumina Truseq kit ...
-
bioRxiv - Microbiology 2020Quote: ... along with any remaining agarose and 10 μL DAKO fluorescent mounting medium (Agilent S3023) added ...
-
bioRxiv - Immunology 2019Quote: ... Non-specific protein binding was blocked by incubation with 10% normal goat serum (DAKO). Primary antibodies were applied overnight at 4 ...
-
bioRxiv - Biochemistry 2021Quote: ... 8×60K GSE ‘all 10-mer universal’ oligonucleotide arrays (AMADID #030236; Agilent Technologies, Inc.) were double-stranded and used in PBM experiments essentially as described previously ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then washed in PBS and blocked with 10% normal goat serum (Dako) and subsequently incubated with rabbit anti-p-S6 ser240/244 antibody (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then washed in PBS and blocked with 10% normal goat serum (Dako) and then incubated with rabbit anti-POMC antibody (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then washed in PBS and blocked with 10% normal goat serum (Dako) and then incubated with rabbit anti-p-S6 antibody (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then washed in PBS and blocked with 10% normal goat serum (Dako) and incubated with rabbit anti-POMC antibody (1:2000 ...
-
bioRxiv - Microbiology 2022Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng of the sample was used for pulsed-field (Agilent, FP-1002-0275) or standard capillary electrophoresis Tape Station (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10-minute protein block step with Serum-Free Protein Block (X0909, Agilent DAKO) to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10-minute protein block step with Serum-Free Protein Block (X0909, Agilent DAKO) to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK ...
-
bioRxiv - Molecular Biology 2019Quote: DNA cloning was performed using chemically competent Escherichia coli XL-10 Gold (Agilent Technologies) grown in LB medium (5 g L−1 yeast extract ...
-
bioRxiv - Cell Biology 2019Quote: ... All samples (10 μl for each injection) were separated by a C18 column (Agilent) using reverse-phase ultra-performance liquid chromatography and analyzed by an Agilent 6410 QQQ triple-quadrupole LC mass spectrometer using positive electrospray ionization mode ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Samples were washed and blocked for 10 min (Dako protein block, Agilent, CA, USA) before being treated with primary antibodies overnight ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Samples were washed and blocked for 10 min (Dako protein block, Agilent, CA, USA) before being treated with primary antibodies overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... in a total reaction volume of 10 μl in Mx3000p and Mx3005 thermocyclers (Agilent). Prior to PCR ...
-
bioRxiv - Immunology 2021Quote: ... Non-specific protein binding was blocked by incubation with 10% normal goat serum (DAKO). The nonspecific binding of antibodies was blocked using 10% normal goat serum (DAKO ...
-
bioRxiv - Biochemistry 2022Quote: ... coli (e.g. Invitrogen TOP10, cat. no. C404003; Agilent Technologies XL-10, cat. no. 200315)
-
bioRxiv - Cancer Biology 2022Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalizer (Agilent, Waldbronn, Germany). 2.5 µg (100 ng/µL ...
-
bioRxiv - Neuroscience 2022Quote: ... and left to air dry for approximately 10 minutes before being coverslipped (Dako, Denmark) with PermaFluor aqueous mounting medium (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalyzer (Agilent, Waldbronn, Germany).
-
bioRxiv - Systems Biology 2023Quote: ... 175 ul of 10 mg/mL salmon sperm DNA (Agilent Technologies, Santa Clara, CA) were added ...
-
bioRxiv - Synthetic Biology 2024Quote: Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Systems Biology 2024Quote: ... 10 μL of supernatant was injected via an autosampler in an HPLC machine (Agilent) with an Aminex HPX 87H (300×7:8 mm ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Profinder Analysis software (version B.10, Agilent Technologies) and confirmed by comparison with authentic standards ...
-
bioRxiv - Microbiology 2023Quote: ... Data analysis was performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies) and confirmed by comparison to authentic standards ...
-
bioRxiv - Bioengineering 2023Quote: 96-well hydrogels were imaged on the Cytation 10 confocal imaging system (Agilent, BioTek) at either 20x or 40x magnification ...
-
bioRxiv - Biochemistry 2023Quote: ... and 10 µl was injected into a reversed-phase HPLC system (Agilent 1260 series) using an Agilent Poroshell EC-C18 column (1.9-micron ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM glutamine and 10 mM glucose (All from Agilent, Santa Clara, CA, USA). The plates were read using a XF HS Mini analyser (Agilent ...
-
bioRxiv - Plant Biology 2024Quote: ... using 10 uL of Brilliant III Ultra-Fast SYBR Green Master-Mix (Stratagene, USA), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA quality control measurement was done using the High Sensitivity RNA Kit and RNA 6000 Nano Kit (Agilent Technologies). Ovation® RNA-Seq System V2 (NuGEN ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2019Quote: ... The RNA was DNase treated using Turbo DNA free kit according to manufacturer’s protocol (Thermo Fischer scientific) for making cDNA using Accuscript hi-fidelity cDNA synthesis kit (Agilent). The qRT-PCR was set up using brilliant III ultra-fast SYBRgreen qPCR master mix in Mx3005P qPCR system Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...