Labshake search
Citations for Agilent :
351 - 400 of 3384 citations for Anti human IgE Conjugated to 40 nm Gold since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated for 90 minutes in a biotin conjugated secondary antibody (a goat anti-rabbit, a goat anti-mouse or a swine anti-rabbit as appropriate; Dako; diluted 1:500) and for 1h in a peroxidase conjugated extravidin (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transformed into XL10-Gold Ultracompetent bacteria (Agilent). The plasmids were purified with Qiagen Spin Miniprep Kit.
-
bioRxiv - Bioengineering 2020Quote: Proteins were expressed in BL21(DE3)Gold (Stratagene) and purified as described previously6 ...
-
bioRxiv - Microbiology 2020Quote: ... Escherichia coli strains BL21-gold (DE3) (Agilent Technologies) and XL10-gold (Stratagene ...
-
bioRxiv - Bioengineering 2022Quote: ... coli strain XL10-Gold was purchased from Agilent for gene cloning ...
-
bioRxiv - Biophysics 2021Quote: ... coli BL21 (DE3)-gold competent cells (Agilent Technologies) transformed with the pT7-7 plasmid encoding α-synuclein ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and transformed into either BL21-Gold(DE3) (Agilent) or TOP10 (Thermo Fisher ...
-
bioRxiv - Biophysics 2023Quote: ... coli BL21 (DE3)-gold cells (Agilent Technologies, USA), as described 52 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... coli BL21 Gold (DE3) strain (Stratagene, CA, U.S.A.) and purified as described previously 35 ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli BL21(DE3)Gold (Agilent, Santa Clara, USA) were inoculated at an OD600 of 0.1 into 50 mL LB-Amp in 200 mL shaking flasks at 37 °C with 180 rpm and protein expression was induced at OD600 0.5 with a final concentration of 0.3% L-arabinose ...
-
bioRxiv - Cell Biology 2023Quote: ... and transformed into XL10 Gold competent cells (Agilent). Bsp11-407 was amplified using primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgccgtttcttcaggttattcc ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with 100 µg/mL of ampicillin (amp100 ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Biochemistry 2024Quote: ... was transformed into BL21-Gold (DE3) strain (Stratagene). Transformed cells were grown in LB media supplemented with Kanamycin (50 mg l-1 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli BL21-Gold(DE3) (Agilent, Santa Clara, USA) cells transformed with the respective pET28a construct were grown in lysogeny broth (LB ...
-
bioRxiv - Immunology 2024Quote: ... coli BL21-Gold (DE3) (Agilent, Santa Clara, CA) for overexpression ...
-
bioRxiv - Biophysics 2020Quote: ... using 561 nm (ZDK-p2a-FusionRed) and 650 nm (iRFP-AsLOV2) modules (Agilent) laser lines ...
-
bioRxiv - Molecular Biology 2021Quote: ... on ice for 30 min and then Alexa 647-conjugated anti-rabbit IgG (Dako). The cells were analysed with a Beckman-Coulter FC-500 Analyzer (Coulter Electronics ...
-
bioRxiv - Cell Biology 2021Quote: ... horseradish peroxidase (HRP) conjugated polyclonal goat anti-rabbit IgG (Dako, Agilent, Les Ulis, France), HRP conjugated StrepTactin (IBA GmbH ...
-
bioRxiv - Cell Biology 2021Quote: ... horseradish peroxidase (HRP) conjugated polyclonal goat anti-rabbit IgG (Dako, Agilent, Les Ulis, France), HRP conjugated StrepTactin (IBA GmbH ...
-
bioRxiv - Genetics 2022Quote: ... or goat anti-rabbit IgG conjugated to HRP (1:2000, Agilent Cat# P0448, RRID:AB_2617138), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... cells were stained with a FITC-conjugated goat anti-rabbit IgG (Dako; 1:200) and visualized using a ChemiDoc MP imaging system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... and a secondary fluorescein isothiocynate (FITC)-conjugated goat anti-mouse IgG (Dako; 1:200) in 1% BSA were added to cells for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The secondary antibody was horseradish peroxidase-conjugated goat anti rabbit IgG (1:2000) (Dako).
-
bioRxiv - Immunology 2021Quote: ... membranes were incubated with anti-mouse secondary antibody conjugated to horseradish peroxidase (HRP) (DAKO) or anti-goat secondary antibody conjugated to HRP (DAKO) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by a horseradish peroxidase conjugated rabbit anti-swine immunoglobulin (Dako A/S, Denmark) diluted to 0.125 µg/ml in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and swine-anti-rabbit-HRP conjugated secondary antibody (1:1000; P0217; DAKO, Agilent, USA). Detection of antibodies was performed using Intas Infinity ECL Starlight (Intas ...
-
bioRxiv - Cell Biology 2023Quote: ... and swine-anti-rabbit-HRP conjugated secondary antibody (1:1000; P0217; DAKO, Agilent, USA). Detection of antibodies was performed using Intas Infinity ECL Starlight (Intas ...
-
bioRxiv - Developmental Biology 2023Quote: ... or anti-mouse horseradish peroxidase (HRP)-conjugated immunoglobulins (1:200, catalog no. P0339, Dako). For HRP-based immunohistochemistry ...
-
bioRxiv - Genetics 2023Quote: ... sections were incubated with a Horseradish peroxidase (HRP)-conjugated Goat anti-mouse secondary (Dako) for one hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... or rabbit anti-Goat IgG horseradish peroxidase-conjugated secondary antibody (0.125 µg/ml; Dako) for 2h at RT with constant agitation ...
-
bioRxiv - Immunology 2023Quote: ... Immunodetection was performed by incubation with horseradish peroxidise-conjugated anti-rabbit (1:5000) (DAKO) and developed by enhanced chemiluminescence (Millipore).
-
bioRxiv - Immunology 2022Quote: ... 100μL per well of anti-mouse HRP-conjugated antibody (Cat. No. P0447, Agilent Dako) was applied at 0.1mg/mL in 0.1% BSA (w/v ...
-
bioRxiv - Immunology 2022Quote: ... 100μL per well of anti-mouse HRP-conjugated antibody (Cat. No. P0447, Agilent Dako) was applied at 0.1mg/mL in 0.1% BSA (w/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by HRP-conjugated anti-mouse secondary antibody polymer (EnVision+; Dako-Cat# K400311-2) and visualized by Cy7-tyramide as substrate ...
-
bioRxiv - Pathology 2024Quote: ... followed by incubation with a horseradish-peroxidase conjugated swine anti-rabbit secondary antibody (Dako). Imaging was performed with an ImageQuant LAS 4000 apparatus (GE Healthcare).
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was then incubated with HRP-conjugated polyclonal swine anti-rabbit antibody (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was then incubated with HRP-conjugated anti-mouse immunoglobulins (1:2000) (Agilent, Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then emission spectra of the C-992 were recorded in the range 420 nm to 600 nm after excitation at its absorption maxima 370 nm in Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies, India).
-
bioRxiv - Genomics 2020Quote: ... LECs were additionally co-stained with mouse anti-human CD31 antibody (clone JC70A, Dako) at a dilution of 1:50 ...
-
bioRxiv - Immunology 2022Quote: ... IgG binding was detected by incubation with Cy3-rabbit anti-human IgG (Dako Cytomation) labeled according to the manufacturer’s recommended protocols (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... tissue sections were firstly stained with monoclonal anti-human CD45 (DAKO, 2B11+PD7/26), CD20 (DAKO ...
-
bioRxiv - Immunology 2023Quote: ... or IgA (polyclonal rabbit anti-human IgA/HRP, Dako, P0216, at 1:2000 dilution) was added for 1 hr at room temperature and the enzyme reaction was developed with TMB plus (Kementec ...
-
bioRxiv - Immunology 2023Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... mouse IgG1 anti-human CK 19 (clone: RCK108, GA61561-2, Dako, Carpinteria, CA, USA), and mouse EpCAM ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-human leukocyte antigen (HLA)-DR (1:200 Agilent, M0746, TAL.1B5 clone) in blocking solution overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... A corresponding anti-rabbit or anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody at a dilution of 1:7000 (Dako) or 1:2000 (Pierce ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked in TBS + 0.1% Tween 20 and 5% dried skimmed milk powder and probed with relevant primary antibodies followed by horseradish peroxidase (HRP)-conjugated polyclonal goat anti-mouse and polyclonal goat anti-rabbit secondary antibodies (Dako). Membranes were treated with EZ-ECL (Geneflow ...