Labshake search
Citations for Agilent :
351 - 400 of 4052 citations for 6 Iodo 2 methyl 4H 3 1 benzoxazin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Plant Biology 2021Quote: ... One experiment was analyzed by ultra-high-performance LC (UHPLC, LC 1290 Infinity (Agilent Technologies) coupled to a HRMS (6540 UHD Accurate-Mass Q-TOF LC-MS instrument (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using SYBR Green One-Step (Kit# 600825, Agilent, Santa Clara, CA). qRT-PCR data were analyzed using the Sequence Detection System software (SDS Version 2.2 ...
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of the derivatized samples were analyzed on a Combi-PAL autosampler (Agilent Technologies) coupled to an Agilent 7890 gas chromatograph coupled to a Leco Pegasus 2 time-of-flight mass spectrometer (LECO ...
-
bioRxiv - Genetics 2022Quote: ... and in one individual by CHOP using the Agilent SureSelect Clinical Research Exome Kit (Agilent). Analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... one of the 96-well plates was evolved in the BioTek Epoch2 microplate reader (Agilent). Populations were frozen every fourth transfer and at timepoints of particular interest (e.g. ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus was expanded by one round of infection of Ad-293 cells (Agilent 240085) at 5 plaque forming units (PFU ...
-
bioRxiv - Genomics 2024Quote: ... One microgram of adaptor-ligated library was hybridized using the SureSelect XT capture kit (Agilent) and our custom-designed 41K promoter Capture-C probe set31 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 μg of pAAV-RC (Stratagene), and 4 μg of pHelper (Stratagene) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 4 μg of pHelper (Stratagene). The other was 1 mL of Opti-MEM plus 45 μL of Lipofectamine® 2000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×44K (G4112F, Agilent Technologies, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... and 4% normal goat serum (Dako) in PBS for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... membranes were incubated with rabbit anti-mouse horseradish peroxidase (HRP) conjugated antibody (P026002-2, Dako, 1:1000) as secondary antibody at RT for 1 h ...
-
bioRxiv - Bioengineering 2019Quote: ... Hydrogels were incubated in a 1:100 dilution mouse anti-human CD31 primary antibody (Agilent IS61030-2) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasma (50 µL) was diluted with 150 µL of buffer A (1:4 dilutions, as recommended by Agilent Technologies), and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2019Quote: ... for one hour at room temperature and incubated overnight at 4°C with 1:200 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... High mass accuracy was achieved by infusion of 1:4 diluted ESI low concentration tune mix (Agilent Technologies, Waldbronn, Germany) at the start of each chromatographic run ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...