Labshake search
Citations for Agilent :
351 - 400 of 3430 citations for 6 CHLORO 1 METHYL 5 INDOLECARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... and fluorenylmethoxycarbonyl (FMOC) was based on the application note “Automated amino acids analysis using an Agilent Poroshell HPH-C18 Column” by Agilent. The samples were injected onto a 100 mm x 3 mm InfinityLab Poroshell HPH-C18 column (2.7 μm ...
-
bioRxiv - Cell Biology 2020Quote: Samples from all biological replicates were first sent to the Stanford University Protein and Nucleic Acid Facility (Stanford, CA) for quantification and quality analysis using a 2100 Bioanalyzer (Agilent). Samples were then sent to Novogene Corporation Inc ...
-
bioRxiv - Biochemistry 2020Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Cell Biology 2019Quote: ... the coding sequence for 81 amino acids downstream of the internal restriction site BsrGI in a construct expressing Gas1* was removed using the QuikChange protocol (Agilent), yielding VGc389 ...
-
bioRxiv - Immunology 2020Quote: ... The codon encoding residue 241 of Copa was mutated from glutamic acid to lysine via Quikchange Lightning site directed mutagenesis (Agilent). Following NotI and PacI digestion ...
-
bioRxiv - Immunology 2019Quote: Purified recombinant His-tagged C-terminal MSP1 protein (amino acids 4960 to 5301) (Ndungu et al., 2009) was biotinylated and tetramerized with streptavidin-PE (Prozyme), as previously described (Krishnamurty et al. ...
-
bioRxiv - Genetics 2019Quote: ... into the complete open reading frame of the canonical 307 amino acid human NMNAT2 isoform cloned into expression vector pCMV-Tag2 (Stratagene). The expressed NMNAT2 proteins have a Flag tag and short linker sequence (17 amino acids ...
-
bioRxiv - Microbiology 2020Quote: ... Hydrolyzed amino acids were separated using ultra performance liquid chromatography (UPLC, Acquity, Waters) on a C-8 column (Zorbax Eclipse XBD, Agilent) at a flow rate of 0.6 mL/min ...
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Bioengineering 2020Quote: ... rehydrated slides were subject to antigen retrieval using citric acid buffer at 120°C and 20 psi in a pressure cooker (DAKO). Afterwards ...
-
bioRxiv - Biophysics 2020Quote: ... Chromatographic separation of OPA-derivatized amino acids was performed using an Agilent ZORBAX Eclipse AAA column (4.6mm x 150 mm x 3.5 μm; Agilent #963400-902) coupled with a ZORBAX Eclipse AAA Analytical Guard Column (4.6 mm x 12.5 mm x 5 μm ...
-
bioRxiv - Microbiology 2021Quote: Levels of volatile fatty acids present in the supernatant of both co-cultures and monocultures were measured using an Agilent1260 Infinity HPLC (Agilent). Samples were prepared by acidifying to 5 mM using sulfuric acid and subsequently incubating at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... The 13C-labeling patterns of proteinogenic amino acids were determined on a 6890N Network GC system with a 5975 inert XL mass selective detector (Agilent Technologies Inc. ...
-
bioRxiv - Immunology 2022Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (catalog no ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: The conservative lysine at position 23 was replaced with glutamic acid to create Meier-Gorlin mutation (K23E) following site-directed mutagenesis protocol (Agilent). Drosophila-Human and Human-Drosophila hybrids were designed by using a PCR technique ...
-
bioRxiv - Plant Biology 2021Quote: Salicylic acid (SA) was extracted from frozen leaf material and analyzed by ultra-high-performance liquid chromatography system (Agilent Technologies) coupled to an Agilent 6530 quadrupole time of flight-mass spectrometer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: The mCherry-TRAK1 deletion mutant mCherry-TRAK1Δ was obtained by inserting a stop codon after amino acid 635 of the mCherry-TRAK1 encoding nucleotide sequence by means of a PCR-based mutagenesis (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene). The GFP-Rem-T7 partial deletion mutants (GFP-RemΔ103-155-T7 ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries were submitted to the VCU’s Nucleic Acid Sequencing core facility where the quality of the libraries was verified using the bioanalyzer (Agilent Technologies).
-
bioRxiv - Physiology 2023Quote: ... Yttrium concentrations were determined in diets and feces after an acid digestion with HNO3 and measured with a coupled plasma-mass spectrometry (Agilent 4200 MP-AES ...
-
bioRxiv - Physiology 2022Quote: ... This construct has an artifactual amino acid change in its coding sequence (I143V) and site-directed mutagenesis (Quikchange II XL, Agilent) was performed to convert it back to WT with following two primers (all primers were ordered from Integrated DNA Technologies):
-
bioRxiv - Molecular Biology 2022Quote: ... Free fatty acids were separated on a Zorbax StableBond aq column (dimension: 2.1mm x 50mm, particle size: 1.7µm) (Agilent technologies, 827700–914) at 0.6ml/min using a mobile phase solvent consisted of 0.06% acetic acid in water (A ...
-
bioRxiv - Immunology 2023Quote: ... stopped with Stop Solution (acid) and absorbance values were recorded at 450 nm on a spectrophotometer (using a BioTeck Gen5 plate reader (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Microbiology 2023Quote: Binding of VHHs to spike proteins on the surface of mammalian cells was determined by flow cytometry using pcG1-expression plasmids containing the coding sequence of the SARS-CoV-2 spike protein from which the C-terminal 18 amino acids were deleted and in which the D614G substitution was introduced by QuickChange site-directed mutagenesis (Agilent) according to the manufacturer’s instructions ...