Labshake search
Citations for Agilent :
351 - 400 of 2118 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... oligomycin (1 µM) and 2-deoxy-D-glucose (2-DG) (50 mM) (Seahorse Glycolysis Stress Test Kit, Agilent Technologies, 103020-100). Analyses were performed with Wave software 2.3.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4 °C) and blocking of endogenous peroxidase (peroxidase block; Dako) for 10 min at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked with Protein-Block reagent (Dako, X090930-2) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μl of sample was subjected to TapeStation (Agilent) analysis to ascertain band sizes ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse anti-Ki67 (1:400, M724029-2, Agilent, UK) was used to label proliferative cells and rabbit anti-cleaved-Caspase3 (1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki-67 (M7240) (M724029-2, Agilent, 1:400 dilution), γH2AX (phospho-S139 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse clone CR3/43 (1:20, Agilent, M077501–2). Sections were incubated for 1 hour at room temperature with secondary antibodies (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... and anti-rabbit IgG HRP-linked (P044801-2, Dako). The IRE1 inhibitor STF083010 was purchased from Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions ...