Labshake search
Citations for Agilent :
3901 - 3950 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... the distribution of size was qualified by the High-Sensitivity DNA Kit (5067-4627, Agilent®). Pre-sequencing QC was performed by Bioanalyzer traces ...
-
bioRxiv - Pathology 2024Quote: ... the sections were incubated with horseradish peroxidase (HRP) secondary mouse antibody (DAKO Envision kit cat# K4001) for 30 min and the staining was visualized using 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2024Quote: ... All libraries were assessed using a High Sensitivity DNA Analysis Kit for the 2100 Bioanalyzer (Agilent) and KAPA Library Quantification kit for Illumina (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... final RNA quality and integrity were assayed using the DNA 12000 kit on the Bioanalyzer (Agilent) at the KU Leuven Genomics Core (https://www.genomicscore.be/).
-
bioRxiv - Neuroscience 2024Quote: ... mut-shM4 (Table 5) and the QuikChange Multi Site-Directed Mutagenesis kit (200514; Agilent; Manufacturer Instructions) in several assays until all the mutations were incorporated ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (PacBio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The quality of DNA extracts wase assessed on a Bioanalyzer High Sensitivity DNA kit (Agilent, USA) and DNA was quantified using a Qubit fluorometric quantification with the ds DNA High Sensitivity assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... Purified samples were analyzed on a 2100 Bioanalyzer instrument employing DNA 1000 Kit reagents (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... and size distribution and degradation assessed using the Femto pulse Genomic DNA 165 kb Kit (Agilent). Purification steps were performed using AMPure PB beads (PacBio ...
-
bioRxiv - Cell Biology 2023Quote: ... site-directed mutagenesis was carried out on pBridge ApoER2-FL using the QuikChange mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... RNA was first reverse-transcribed with MARSseq barcoded RT primers with the Affinity Script kit (Agilent). Reverse transcription was analyzed by qRT-PCR and samples with a similar CT were pooled ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using an RNA 6000 Nano kit (5067-1511, Agilent) on a 2100 Bioanalyzer from Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Developmental Biology 2023Quote: ... The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and quantified using the Qubit dsDNA HS Kit (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Bioengineering 2023Quote: ... The resulting RNA-seq libraries’ quality and concentration were assessed using the D1000 DNA Kit (Agilent) on the TapeStation and a Qubit Fluorometer with the Qubit dsDNA HS Assay Kit (Life Technologies) ...
-
bioRxiv - Systems Biology 2024Quote: ... The DNA quality was assessed with an Agilent Bioanalyzer 2100 with a DNA 12000 Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... The integrity of the RNA was determined using the TapeStation High Sensitivity RNA kit (Agilent Technologies). 10 ng of total RNA has been used to prepare ribo-depleted RNA-seq libraries with these kits ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Cell Biology 2024Quote: ... size distribution was examined on the Fragment Analyzer with High Sensitivity NGS Fragment Analysis kit (Agilent), to ensure that the samples were the proper size ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples with RIN values ≥9.5 (assessed using using Agilent RNA 6000 Nano Kit (Agilent #5067-1511)) were carried forward for library prep using QuantSeq Forward kit (LEXOGEN #015.96 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HCK ORFs were performed using QuickChange Lightening Site-Directed Mutagenesis kit (Agilent Technologies, Les Ulis) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quantity and quality were assessed using an Agilent RNA 6000 Pico Kit (#5067-1513; Agilent) with a 2100 Bioanalyzer (#G2939BA ...
-
bioRxiv - Biophysics 2024Quote: ... Mutants of BOSS and dROS1 were generated by site-directed mutagenesis using QuickChange Kit (Agilent Technologies). Proteins were purified from the medium (Ex-Cell405 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA quality was further assessed using a total RNA kit on a 2100 Bioanalyzer (Agilent Technologies) and using the generated RIN number to determine quality ...
-
bioRxiv - Cancer Biology 2023Quote: ... and by using High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment AnalyzerTM (Agilent). Libraries were then purified using Agencourt® AMPure® XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quality was tested using the Bioanalyser Agilent RNA 6000 Pico Kit (Agilent Technologies, Waldbronn, Germany). Sequencing libraries were prepared with the TruSeq RNA Sample Prep Kit v2 and sequenced on the Illumina HiSeq 2000 ...
-
bioRxiv - Genomics 2024Quote: ... and fragment lengths were determined using the Genomic DNA 165 kb Kit (Agilent #FP-1002-0275) on the Femto Pulse System.
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 250ng RNA of each sample was retro-transcribed using Affinity Script cDNA synthesis kit (Agilent Technologies). 5ng of cDNA was used for the qRT-PCR reaction using Brilliant III Ultrafast SYBR Green QPCR master mix (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and sample quality was determined using the RNA 6000 Nano Kit on a 2100 BioAnalyzer (Agilent). Sequencing libraries were prepared using the TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA integrity number (RIN) and concentration were determined using an Agilent RNA 6000 Pico kit (Agilent). NEBNext Poly(A ...
-
bioRxiv - Biochemistry 2022Quote: ... The final library pool quality was checked with Bioanalyzer (Agilent, High Sensitivity DNA Kit, 5067-4626) and qPCR (Kapa library quantification kit ...
-
bioRxiv - Genomics 2022Quote: ... Library quality was assessed using the ZAG 110 dsDNA kit on (Agilent, CAT. ZAG-110-5000) and run on the ZAG DNA analyzer system (Agilent) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Extracellular flux analysis was performed using the Seahorse XF Cell Mitochondrial Stress Test kit (Seahorse Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the SureSelect Methyl-Seq Library Prep Kit ILM (Agilent Catalog # 5500-0128) included the indices for pooled sequencing ...