Labshake search
Citations for Agilent :
3901 - 3950 of 6556 citations for Mouse Butyrylcholinesterase BCHE CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... RIN number determination was completed according to manufacturer instructions using a Bioanalyzer RNA 6000 Nano kit (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Truncations were generated by stop codon insertion mutagenesis with QuikChange II XL mutagenesis kit (Agilent, cat# 200522), and GFP fusion expressing the STAT2 CC domain alone was constructed by PCR with specific primers to enable cloning into plasmid pEGFP-N1 or pEGFP-C1 ...
-
bioRxiv - Microbiology 2021Quote: ... Sample quality was assessed using an Agilent 2100 Bioanalyzer system and corresponding RNA 6000 Nano kit (Agilent) to determine RNA concentration and to confirm RNA integrity ...
-
bioRxiv - Immunology 2020Quote: ... Library size distribution was evaluated on the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced using an Illumina NextSeq 500 instrument using 76 bp single-end high-output configuration.
-
bioRxiv - Immunology 2020Quote: ... and RNA intergrity was verified with Agilent RNA 6000 Nano kit on the 2100 Bioanalyzer (Agilent Technologies) according to the manufacturers’ protocol ...
-
bioRxiv - Genomics 2021Quote: ... RNA integrity was assessed on the Agilent Bioanalyzer using the RNA 6000 Nano Chip kit (Agilent Technologies). An RNA integrity number (RIN ...
-
bioRxiv - Immunology 2021Quote: ... Library size and quality were measured by Bioanalyzer using a High Sensitivity DNA Analysis Kit (Agilent Technologies). Sequencing libraries were prepared from WTA product using Nextera XT (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... was used to determine RNA integrity with the RNA 6000 Pico Kit (Agilent, catalog no. 5067-1513), and a Qubit (ThermoFisher ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... RNA quality and quantity were evaluated using a BioAnalyzer 2100 with RNA 6000 Nano Kit (Agilent Technologies). Stranded RNA-Seq libraries were constructed from 100 ng high-quality total RNA (RIN > 8 ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product fragment sizes were assessed using an Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) on a Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2021Quote: ... and the exonic regions were captured with Agilent SureSelect Human All Exon v7 Kit (Agilent, 5191-4005). Whole exome sequencing (WES ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and their integrity was assessed via 1% agarose gel electrophoresis or Bioanalyzer RNA 6000 Nano kit (Agilent). Library quantification ...
-
bioRxiv - Genetics 2020Quote: ... RNA quantity and purity were analyzed on a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent). Total RNA was subjected to isolate Poly (A ...
-
bioRxiv - Immunology 2021Quote: ... Overall library quality and concentration was determined on the Fragment Analyzer (Agilent DNF-473 NHS Fragment kit). All libraries were then pooled and sequenced on an Illumina MiSeq using the reagent v3 kit (2x300 bp ...
-
bioRxiv - Immunology 2021Quote: ... Overall library quality and concentration was determined on the Fragment Analyzer (Agilent DNF-473 NHS Fragment kit). Libraries were then pooled in Tris-HCl + 0.1% Tween-20 (Teknova T7724 ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA was polyadenylated with a miRNA First-Strand cDNA synthesis kit (Agilent Technologies Inc., CA, USA), following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Sample quality was assessed using an Agilent 2100 Bioanalyzer system and corresponding RNA 6000 Nano kit (Agilent) to confirm RNA integrity ...
-
bioRxiv - Developmental Biology 2022Quote: ... The mutant construct for Gpdh was made using QuickChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies #210518). The wildtype construct was used a template for mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Each mutagenesis reaction was performed using QuikChange II Site-directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) and the mixtures were made according to manufactures guidelines ...
-
bioRxiv - Cancer Biology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Biophysics 2022Quote: ... Relative permittivity and electrical conductivity were measured using a dielectric probe kit (85070 E, Agilent Tech. Inc.) for a range of frequency between 950 MHz and 2400 MHz and heat capacitance was measured using a KD2 thermal properties analyzer (Decagon Devices Inc.).
-
bioRxiv - Biophysics 2022Quote: ... Relative permittivity and electrical conductivity were measured using a dielectric probe kit (85070 E, Agilent Tech. Inc.) for a range of frequency between 950 MHz and 2400 MHz and heat capacitance was measured using a KD2 thermal properties analyzer (Decagon Devices Inc.).
-
bioRxiv - Cancer Biology 2022Quote: ... Mitochondrial respiration was studied by monitoring OCR using Seahorse Cell Mito Stress Test kit from Seahorse Bioscience and glycolytic activity was studied by monitoring ECAR using Seahorse Glycolysis Stress Test Kit from Seahorse Bioscience. Cells were plated at a density of 1 × 104 cells per well ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mitochondrial respiration was studied by monitoring OCR using Seahorse Cell Mito Stress Test kit from Seahorse Bioscience and glycolytic activity was studied by monitoring ECAR using Seahorse Glycolysis Stress Test Kit from Seahorse Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...
-
bioRxiv - Cancer Biology 2022Quote: ... The libraries were analyzed for insert size distribution by using a 2100 BioAnalyzer High Sensitivity kit (Agilent). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA concentration and integrity were determined using the Bioanalyzer High Sensitivity RNA Pico Kit (Agilent #5067-1513). Sequencing libraries were prepared using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs #E6420 ...
-
bioRxiv - Cell Biology 2022Quote: ... according to the manual of Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, cat#103015-100). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was then purified and transcribed using the RNA MAXX In Vitro Transcription Kit (Agilent) to produce the sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in two runs of the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by size distribution analysis in the Agilent 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent). Libraries were sequenced in the Illumina NextSeq 500 instrument (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Library quality and size distribution was verified using a TapeStation D5000 HS kit (Agilent Technologies, 5067-5592). Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp ...
-
bioRxiv - Genomics 2022Quote: ... The library size was estimated on Agilent Bioanalyzer 2100 using high sensitivity DNA kit (Agilent, United States). The normalized libraries were sequenced for 150 bp paired-end reads on Illumina NextSeq 500 platform using NextSeq 500/550 v2 and v2.5 sequencing reagent kits (Illumina Inc. ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The mRNA-seq libraries were constructed by using SureSelect Strand Specific RNA Library Prep kit (Agilent Tech.) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). For expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... This was achieved by site-directed mutagenesis (QuikChange II Site Directed Mutagenesis Kit (Agilent, Santa Clara, CA)) using the primers EmaA-Pro-X-Gly-F and EmaA-Pro-X-Gly-R (Table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The mVSGG1954 mutant S321A was generated by site-directed mutagenesis using the QuikChange Lightening kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... pooled and checked again using a Bioanalyzer (Agilent High Sensitivity DNA Kit, Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Site-directed mutagenesis was performed using a QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library size was verified with a Bioanalyzer using an Agilent High Sensitivity DNA kit (Agilent Technologies). The concentration of each library was determined using the KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sequencing libraries were analyzed on an Agilent 2100 Bioanalyzer (High sensitivity DNA analysis kit, Agilent, 5067-4626) pooled in equimolar amounts (2.8 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... AIRR-seq libraries were then quality controlled using the 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA quality was determined with Agilent’s 2100 Bioanalyzer using the High Sensitivity DNA Kit (5067-4626, Agilent) according to manufacturer’s instructions (representative images in Fig 1b).
-
bioRxiv - Microbiology 2022Quote: ... and an Agilent FEMTO Pulse System with a Genomic DNA 165 kb Kit (Agilent, FP-1002-0275), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...