Labshake search
Citations for Agilent :
3901 - 3950 of 6813 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and quantified using the Qubit dsDNA HS Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RIN score was determined using a Bioanalyzer RNA 6000 Nano kit (Agilent, cat.no 5067-1511) in combination with the Agilent Bioanalyzer software ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Neuroscience 2023Quote: ... and H486R) were then introduced into this construct by QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using the corresponding primers (Primer List below ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... Quality of the RNA extraction was assessed using the 2100 Bioanalyzer (Agilent, RNA 6000 Nano Kit) and selecting samples with a RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed recombinant RlmI mutations using a QuikChange Site-Directed Mutagenesis Kit (#200518, Agilent Technologies, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7,7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... TFRC or 4-HNE was detected by using a Dako EnVision FLEX kit (Dako, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity number (RIN) was determined with Agilent RNA 6000 Nano Kit (Agilent, Cat. # 5067-1511) for quality check and all samples were above 8.5.
-
bioRxiv - Biochemistry 2024Quote: ... Mutations were introduced to the p38 expression construct using the QuikChange site-directed mutagenesis kit (Agilent). pCDFDuet-MKK6-EE was a gift from Kevin Janes (Addgene plasmid # 82718 ...
-
bioRxiv - Immunology 2024Quote: ... OCRs and ECARs were measured using Seahorse XF Cell Mito Stress Test Kit (103015-100, Agilent) and Seahorse XF Glycolysis Stress Test Kit (103020-100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated by following the microprep RNA isolation protocol and kit by Agilent (CAT#: 400805). RNA concentration after elution was calculated using a nanodrop in ng/µL of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Immunology 2024Quote: ... Total RNA size distribution was determined by RNA 6000 Pico Kit for 2100 Bioanalyzer systems (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quality of DNA samples was analysed using the high sensitivity DNA kit (Agilent 5067-4626) in Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta samples was assessed by Agilent Bioanalyzer 2100 (Fig. S1C) with the Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511). Then total RNA (500 ng per sample ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and DNA quality was verified using a Bioanalyzer 2100 with high-sensitivity DNA kits (Agilent, Japan). Short-inserts of 150-bp paired-end libraries were prepared for each individual using a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The construct cpSRP54(Q185R) was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) with pETDuet1™-cpSRP54 (Bals et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and the size was determined using the TapeStation 4200 with a High Sensitivity D1000 kit (Agilent). All libraries were mixed into a single tube with equal molarity ...
-
bioRxiv - Cell Biology 2024Quote: ... and the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent), respectively ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Neuroscience 2024Quote: RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥8.7 ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and analyzed by using a High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies), verified by DNA sequencing and purified as for the wild-type protein.
-
bioRxiv - Cancer Biology 2021Quote: ... purified libraries were validated and quantified using an Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent, Cat#: 50674626) and a Qubit dsDNA High Sensitivity Quantitation Assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Libraries were sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The quality of purified DNA libraries was assessed using the Agilent High Sensitivity DNA kit (Agilent Technologies). Paired end ...
-
bioRxiv - Cell Biology 2020Quote: ... and SV40 large T antigen (LT) were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Point mutations in FAM111A and FAM111B were introduced using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... P96R-H31Q and F100I-H31Q mutations were generated with the Quick Change Mutagenesis Kit (Agilent Technologies #200517). Human TDP-43 fused to pCherry was described previously [32] ...
-
bioRxiv - Cell Biology 2020Quote: Mutations in PKCε were introduced with the QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA). The following primers were used for PCR ...
-
bioRxiv - Immunology 2021Quote: ... Sample concentration and quality was measured using the HighSensitivity RNA TapeStation kit for the TapeStation Bioanalyzer (Agilent). After confirming the RNA was of sufficient quality using the RINe metric ...
-
bioRxiv - Immunology 2021Quote: ... The staining was visualized using the ABC reagent (ABC vector kit; Vector) and DAB substrate chromogen (Dako). Apoptotic cells in atherosclerotic lesions were stained using the Click-iT Plus TUNEL Assay kit (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... performed DNA library preparation and whole-exome sequencing using Agilent SureSelect Mouse All ExonV6 kit (Agilent Technologies) following recommendations of manufacturer ...
-
bioRxiv - Genetics 2021Quote: ... Library quality was validated using a 2100 Bioanalyzer with the Agilent High-Sensitivity DNA Kit (Agilent Technologies). The library was sequenced on an Illumina HiSeq 1500 platform by paired-end sequencing (100 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated with horseradish peroxidase-linked secondary antibody from the Envision Kit (Dako, K-5007) for 1 hour (100 µl/section ...