Labshake search
Citations for Agilent :
3851 - 3900 of 8653 citations for Rat Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... and the Agilent 2100 Bioanalyzer with RNA 6000 Nano kit (Agilent, Santa Clara, CA, US). All RNA samples had a A260/280 ratio higher than 2.1 and a RIN value higher than 7.8 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The CEBPA and JAK3 mutations were generated using the Quikchange Site Directed Mutagenesis Kit (Agilent) using the primers in Table S7 ...
-
bioRxiv - Cell Biology 2019Quote: ... K-R mutant plasmids were generated using Quikchange II XL site-directed mutagenesis kit (Agilent), with primers listed in Table S5 ...
-
bioRxiv - Genetics 2019Quote: ... RNA quality was assessed on a Bioanalyzer 2100 using the RNA 6000 Nano kit (Agilent). There were 607 samples (one missing sample ...
-
bioRxiv - Molecular Biology 2020Quote: The two linkers were optimized separately using Quikchange II site-directed mutagenesis Lightening kit (Agilent) with customized primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... The UBE2T C86K mutant (UBE2TC86K) was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent). UBE2TC86K was overexpressed in BL21 (DE3) ...
-
bioRxiv - Genomics 2021Quote: ... Library quality control was performed with the Fragment Analyzer high sense small fragment kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... SEP-GluA1-S845A was generated by PCR based QuikChange® Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... All compounds were from a Seahorse XF Cell Mito Stress Test Kit (Agilent, 103015-100). Four OCR measurements were recorded for baseline and following each injection ...
-
bioRxiv - Cell Biology 2020Quote: ... was made from the original construct using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) with the forward primer 5’-CGATGTGGGCGGCCTGCGCGATGAACGCCGC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... S772A and S784A in different combinations were introduced by the Quick Change Mutagenesis Kit (Stratagene). The recombinant proteins were overexpressed in E ...
-
bioRxiv - Microbiology 2020Quote: ... gel purified and labeled with Random Prime it-II kit using 32p-dCTP (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... and validated using Agilent High Sensitivity DNA Kit on a Bioanalyzer (Agilent Technologies, CA, USA). The size range of the DNA fragments were measured to be in the range of app ...
-
bioRxiv - Cell Biology 2020Quote: ... Arg575His Arg575Lys mutants of TRPV1 were prepared by using site directed mutagenesis kit (Agilent Technologies) with specific primer sets as described before21 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations were obtained by site-directed mutagenesis using the QuikChange kit (Stratagene, La Jolla, California). Lep system including the sequences of interest in the P2 region were subcloned into KpnI linearized pCAGGS in-house version using In-Fusion HD cloning Kit (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... MMG1C397A mutation was introduced into MMG1 using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent). For MMGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... and I1074Y were created using the QuikChange® II XL Site-Directed Mutagenesis Kit (Stratagene) using previously described protocols [50] ...
-
bioRxiv - Biochemistry 2021Quote: ... The pEYKBA plasmid was mutagenized by site-directed mutagenesis using the QuikChange II kit (Agilent) to create point mutations in the kinase domain of Bcr-Abl ...
-
bioRxiv - Cancer Biology 2020Quote: ... The quality of the libraries was assessed with the Bioanalyzer High Sensitivity DNA kit (Agilent). The libraries were quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Deep sequencing was performed using a SureSelect Strand Specific RNA Library Prep Kit (Agilent Technologies) and HiSeq2500 (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... The MutL (R-E) mutation was generated using the QuikChange site-directed mutagenesis kit (Stratagene). Two serine residues separated the his6 and srt ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and cloned into pSC-A-amp/kn using a StrataClone PCR Cloning Kit (Agilent Technologies). Plasmids were then Sanger sequenced using T7/T3 primers or the original PCR primers (MWG Eurofins) ...
-
bioRxiv - Microbiology 2020Quote: ... the High-Sensitivity DNA Kit on the Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and via real-time quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... National Institutes of Health) by the QuickChange Lightinig kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacture protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and the Prokaryote total RNA Nano Kit on a Bioanalyzer to measure RIN values (Agilent).
-
bioRxiv - Immunology 2021Quote: ... and transcribed to complementary DNA with Affinity Script Multiple Temperature cDNA Synthesis Kit (Agilent Technologies).
-
bioRxiv - Microbiology 2021Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 System (Agilent Technologies, USA) respectively ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was analyzed for quantity and quality using the RNA 6000 Pico Kit (Agilent). Sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR-based mutagenesis kit exactly as described by the manufacturer (Stratagene, La Jolla, CA, USA). Mutagenized clones were isolated and subjected to Sanger DNA sequencing to verify the entire coding sequence for the presence of the desired mutation and the absence of any PCR-induced sequence errors.
-
bioRxiv - Immunology 2021Quote: ... After validation of the RNA quality with Bioanalyzer 2100 (using Agilent RNA6000 nano chip kit), 75 ng of total RNA was reverse transcribed using the GeneChip® WT Plus Reagent Kit (Affymetrix ...
-
bioRxiv - Immunology 2021Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) to include D614G (original ...
-
bioRxiv - Molecular Biology 2020Quote: Point mutations were generated using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, #210513) if not otherwise stated ...
-
bioRxiv - Genetics 2021Quote: DNA libraries of the purified fragments were constructed with SureSelect Library Prep Kit (Agilent, USA). In brief ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was prepped by reverse-transcriptase PCR using the AffinityScript cDNA QPCR Synthesis kit (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... Library quality and yield was measured using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent) and Qubit dsDNA High Sensitivity Assay Kit (Q32854 ...
-
bioRxiv - Genetics 2020Quote: ... DNMT1 point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent), with the residue numerations based on the isoform 1 of DNMT1 that contains 1616 amino acids ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... We used the QuickChange II XL site-mutagenesis kit (from Agilent Technology, Santa Clara, CA) to substitute wild type sequence with the mutant sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA quality was measured using Agilent RNA 6000 Pico kit (#5067-1513) by Agilent Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality was determined used the Agilent DNA 1000 Kit on a 2100 BioAnalyzer (Agilent). Validated libraries were subjected to 75-bp single-end sequencing on the Illumina NextSeq 500 platform.
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 x 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutations were introduced using the M27-QC primers and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent; 210513). Plasmids were integrated via dual transfection with pCAG-SpCas9-GFP-U6-gRNA (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... The total RNA quality was checked with Bioanalyzer (Agilent, RNA 6000 Nano kit, 5067-1511). Small RNA library preparation started with 1ug high quality total RNA ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770 ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 × 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Bioengineering 2022Quote: ... Alanine mutants of LRP6 ectodomain were generated using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Point mutations were created using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with either the pBRA SP-Tlde1WT plasmid or Tlde1WT pET28b plasmid used as template ...
-
bioRxiv - Cell Biology 2022Quote: ... The R73K mutation was introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The primer for mutagenesis (AATGCGAGCTATCTTTAATCAAGAAAGTTCCTTCTGGTGCC ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA fragments were tested on a 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies ...