Labshake search
Citations for Agilent :
3851 - 3900 of 9205 citations for Mouse Autophagy related protein 16 1 ATG16L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... YAP S61A mutant was generated utilizing a QuikChange site-directed mutagenesis kit (Agilent) and confirmed by sequencing (Eurofins Genomics).
-
bioRxiv - Cell Biology 2023Quote: ... Appropriate mutagenesis was done using QuikChange Lightning Multi Site-Directed mutagenesis kit (Agilent). Final product plasmids were confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: ... Glycolytic parameters were measured using the glycolysis stress test kit (Agilent; 103020-100), measurement of ECAR (extracellular acidification rate ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... Point mutations were generated using the QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... C328H and C328D were generated by site directed mutagenesis using kits from Agilent or Nzytech ...
-
bioRxiv - Cancer Biology 2022Quote: ... and final sequencing libraries were performed using Bioanalyzer High Sensitivity DNA Kit (Agilent). The sequencing libraries for scRNAseq and scTCRseq were normalized to 4nM concentration and pooled using a volume ratio of 4:1 ...
-
bioRxiv - Genomics 2023Quote: ... and assessed for fragment size using the BioAnalyzer HS DNA Assay kit (Agilent). Following library pooling in equimolar concentrations ...
-
bioRxiv - Genomics 2023Quote: ... Individual library Qc was performed using the BioAnalyzer HS DNA Assay kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Mitochondrial respiration was measured using Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Using the DNA high-sensitivity kit in the 2100 Bioanalyzer (Agilent Technologies, USA), the library quality and quantity of the appropriate fragment length (250 bp ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from NSC34 cells using the Absolutely RNA Microprep kit (Agilent). The rRNA levels were measured by real-time quantitative PCR after reverse transcription of RNA ...
-
bioRxiv - Physiology 2023Quote: ... A high sensitivity small DNA Fragment Analysis kit (Agilent Technologies, DNF-477-0500) was used to assess the quality of each library pool.
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was determined using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together for paired-end sequencing on an Illumina Hi-Seq 3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified libraries were run on Agilent High Sensitivity DNA Kit chip (Agilent Technologies) to verify the expected size distribution ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was assessed by high sensitivity DNA analysis kit (Agilent, 5067-4626) on the 2100 Bioanalyzer instrument ...
-
bioRxiv - Plant Biology 2024Quote: ... and Agilent 2100 Bioanalyser using an RNA nano-chip kit (Agilent Technologies, UK). Library preparation was carried out using Illumina® sequencing TruSeq Stranded Total RNA Library Prep Kit before sequencing of 100 bp paired ends reads using Illumina Genome Analyser GXII platform by the Exeter Sequencing Service (University of Exeter) ...
-
bioRxiv - Immunology 2024Quote: ... The primary antibody was detected using the Envision Labeled Kit (Dako, Glostrup, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... All mutation were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). The DNAs were transformed into BL21-Gold(DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was measured using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together and performed paired-end sequencing on an Illumina Hi-Seq 2000.
-
bioRxiv - Neuroscience 2023Quote: ... Mutagenesis was performed using the QuikChange II Site-directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were constructed using the Sure Select All Exon v6 library kit (Agilent) following the XT library preparation workflow ...
-
bioRxiv - Biochemistry 2024Quote: ... Neomorphic missense mutations were introduced using QuikChange Lightning site-directed mutagenesis kit (Agilent). C ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed with AccuScript PfuUltra II RT-PCR Kit (600184, Agilent) and a customized RT-primer including unique molecular identifier (UMI ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis was carried out using the QuickChange Lightning kit from Agilent. The two targeted mutation sites were K112M and D207A ...
-
bioRxiv - Plant Biology 2024Quote: ... using the RNA 6000 Nano Kit for standard RNA sensitivity (Agilent, #5067-1511). Three biological replicates were submitted to Novogene (www.novogene.com ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... diluted 1:33 in BSA 1% in PBS without Ca2+ and Mg2+for 1h at RT or with negative isotype control mouse IgG2a (cat. X0943 - Agilent Technologies, Santa Clara, CA, USA). Then ...
-
bioRxiv - Immunology 2021Quote: ... a monoclonal mouse antibody against the intracellular tail of human HLA-DR α chain was used (Clone TAL.1B5, # M0746, Agilent, Santa Clara, CA, USA). Detection of MHC-I on the surface of cells was performed using a monoclonal mouse antibody against devil beta-2-microglobulin (B2M ...
-
bioRxiv - Immunology 2022Quote: ... then incubated in 5 μg/ml primary antibody in incubation buffer (anti-Mala s 1 mouse monoclonal IgG1 antibody (9G9) from Karolinska Institute (Zagari A et al, 1994, Schmidt et al, 1997) or mouse monoclonal IgG1 antibody (Agilent Dako X093101-2; Santa Clara, USA) as an isotype control for 90 min ...