Labshake search
Citations for Agilent :
3751 - 3800 of 4374 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Cancer Biology 2021Quote: 1×104 OE19 cells were reverse transfected with siRNAs and seeded into 96-well plates (Agilent, 102601-100). 24 hours post-transfection cells were treated with 500 nM lapatinib or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies used for immunoblotting were Horseradish Peroxidase (HRP)-conjugated swine anti-rabbit (DAKO, cat# P0399; 1:4,000) or goat anti-mouse (DAKO ...
-
bioRxiv - Microbiology 2019Quote: ... Japan) equipped with a 30 m × 0.25 mm DB-1 capillary gas chromatography column (Agilent Technologies, CA, USA). For analysis ...
-
bioRxiv - Developmental Biology 2019Quote: ... All samples were sequentially washed and incubated with a mouse monoclonal anti-human CD31 (Dako, M0823, 1:100) and Alexa488-conjugated goat anti-mouse secondary antibody (ThermoFisher ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...
-
bioRxiv - Neuroscience 2019Quote: Antibody specificity was tested using a negative staining procedure with normal rabbit IgG (1:250; Dako, Glostrup, Denmark) instead of the primary antibodies ...
-
bioRxiv - Immunology 2019Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 x 0.5 cm ...
-
bioRxiv - Pathology 2020Quote: ... used at a dilution of 1:50 and a FITC-conjugated rabbit polyclonal antibody to IgA (Dako, F0204). The polyclonal sheep anti-nephrin antibody was also directly conjugated to Alexa-488 using NHS chemistry ...
-
bioRxiv - Immunology 2021Quote: ... MSP-142 and AMA-1 were biotinylated and tetramerized with streptavidin-PE (SA-PE; Agilent, Santa Clara, CA) as previously described.46 A decoy reagent to gate out the non-MSP-142 or AMA-1–specific B cells was constructed by conjugating SA-PE to DyLight 650 (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-SOX17, and anti-SOX9 (MerckMillipore, AB5535, 1:300) antibodies and visualization with EnVision FLEX Mini kit (DAKO).
-
bioRxiv - Pathology 2021Quote: ... the sections were immunostained with antibodies against the following: glial fibrillary acidic protein (GFAP, polyclonal, 1:1,500, Dako); α-smooth muscle actin (SMA ...
-
bioRxiv - Plant Biology 2020Quote: ... The fragments were diluted to reach a concentration range of 1-10 ng/μL as required by Agilent High Sensitivity DNA kit ...
-
bioRxiv - Microbiology 2020Quote: ... Polyclonal goat anti-mouse IgG/HRP and Polyclonal goat anti-rabbit IgG/HRP (1:2000) were from Dako, Denmark ...
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Microbiology 2021Quote: ... plates were probed with 100 μl/well of goat anti-mouse IgG HRP (1:2000; Agilent Dako, Denmark) diluted in PBS/BSA for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... plates were probed with 100 μl/well of goat anti-mouse IgG HRP (1:2000; Agilent Dako, Denmark) diluted in PBS/BSA for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-Spike antibody binding was detected using HRP-conjugated anti-rabbit secondary antibodies (1 in 7000 dilution) (Dako) and visualized using ECL (KPL ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h at room temperature and positive signals were visualized with the diaminobenzidine (DAB) substrate (Dako, #K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slices were incubated with primary antibodies: rabbit polyclonal anti-PSMA/GCPII (1:150) (M362029-2; DAKO, US), anti-CD68 (1:250 ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody (MX-A: Millipore Sigma, MABF938; IBA-1: Wako, 019-19741; CD3: Dako, A0452; MPO: Dako, A0398) was added to slides at a dilution (MX-A ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody (MX-A: Millipore Sigma, MABF938; IBA-1: Wako, 019-19741; CD3: Dako, A0452; MPO: Dako, A0398) was added to slides at a dilution (MX-A ...
-
bioRxiv - Microbiology 2022Quote: ... coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)]) (Stratagene) was used for general cloning and E ...
-
bioRxiv - Microbiology 2022Quote: ... sections were incubated with peroxidase labeled goat-anti-Rabbit IgG (1:100) (P0448, DAKO, Agilent Technologies Netherlands B.V) in PBS/0,1% BSA for 1h at RT ...
-
bioRxiv - Microbiology 2022Quote: ... sections were incubated with peroxidase labeled goat-anti-Rabbit IgG (1:100) (P0448, DAKO, Agilent Technologies Netherlands B.V) in PBS/0,1% BSA for 1h at RT ...
-
bioRxiv - Biophysics 2022Quote: ... HIV-1 GagG2A -EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Venus6 was a gift from Steven Vogel (76 ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1 h at room temperature and positive signals were visualized with the diaminobenzidine (DAB) substrate (Dako, #K3468). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2020Quote: ... the membranes were incubated with the secondary antibody rabbit anti-mouse conjugated to horseradish peroxidase (Dako, 1:2000) for 90 min at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... we performed immunohistochemical stainings against glial fibrillary acidic protein (GFAP, rabbit-anit-GFAP, 1:500, Dako, Hamburg, Germany) counterstained with a Cy3-conjugated secondary antibody goat-anti-rabbit (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... the slices were stained with primary antibodies for GFAP (polyclonal rabbit anti-cow GFAP, 1:500; Z0334, Dako) and NeuN (monoclonal mouse anti NeuN ...
-
bioRxiv - Cancer Biology 2021Quote: ... The blots were subsequently incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako, 1:1000 dilution, Agilent, France) and enhanced chemiluminescence substrate.
-
bioRxiv - Cancer Biology 2021Quote: ... The blots were subsequently incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Dako, 1:1000 dilution, Agilent, France) and enhanced chemiluminescence substrate.
-
bioRxiv - Biochemistry 2020Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 × 0.5 cm ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed with TBS-T and next incubated with secondary HRP-conjugated anti-mouse IgG (1:2,000, DAKO, P0447) for 1 hour at room temperature and developed using the ECL detection kit (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... The following secondary antibodies were used: 1:5000 goat anti-mouse immunoglobulin conjugated to HRP (RRID:AB_2617137, P0447, Agilent) and 1:5000 swine anti-rabbit immunoglobulin HRP conjucated (RRID:AB_2617141 ...
-
bioRxiv - Cell Biology 2022Quote: ... Blots were then washed with PBS-T and incubated with either swine anti-rabbit HRP (1:3000, Dako) or goat anti-mouse HRP (1:3000 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cell nuclei were stained with Hoechst (1:10000) and the coverslips were mounted with DAKO fluoromount medium (Agilent). The primary antibodies were used ...
-
bioRxiv - Genomics 2019Quote: ... Separation of compounds was performed on a 30 m x 0.25 mm ID x 0.25 μm HP-1 Dimethylpolysiloxane column (Agilent) with a temperature program starting from 60 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were prepared exactly as previously described using rabbit anti-GFAP primary antibody (1:1000; Dako, catalog# Z0334) and biotinylated horse anti-rabbit secondary antibody (1:250 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 1 hour before incubation with primary antibody (in DAKO antibody diluent with background reducing components (DAKO, #S3022)) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were then developed with Liquid DAB+ Substrate Chromogen System (1 drop DAB+ per ml of buffer, DAKO), quenched with water and counterstained as follows ...
-
bioRxiv - Pathology 2020Quote: ... sections were incubated with secondary antibodies coupled with HRP (1:200) (DAKO, Agilent Technologies, Santa Clara, CA, USA) for one hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Strips were washed and incubated for 1 hour with a horse radish peroxidase (HRP)-conjugated secondary immunoglobulin (DAKO). The strips were washed and immersed in citrate-EDTA before addition of the TMB substrate for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... and DNF-473 Standard Sensitivity NGS Fragment Analysis Kit (1 bp −6000 bp; Agilent, Santa Clara, CA, USA). Average library length was 341 bp ...