Labshake search
Citations for Agilent :
3701 - 3750 of 4362 citations for Human IgG1 Anti SARS CoV 2 Spike S1 Antibody CR3022 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The signal was visualized with HRP-labeled anti-rabbit polymer (DAKO) and DAB (DAKO) ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-α smooth muscle actin (M0851, DAKO, Santa Clara, CA), mouse anti-beta actin (A5316 ...
-
bioRxiv - Immunology 2021Quote: ... Polyclonal Rabbit Anti-Glial Fibrillary Acidic Protein was purchased from Agilent Dako (Z033401-2) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and anti-Ki67 (MIB-1, Agilent Technologies, Santa Clara, CA, USA) with a monoclonal mouse antibody used at a 1:50 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were incubated with mouse anti-rabbit IgG (Dako; 1:100) for 30 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C3c (DAKO Denmark A/S, Glostrup, Denmark; 1:100) were diluted in PBS + 0.1% Tween20 (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C3d (DAKO Denmark A/S, Glostrup, Denmark; 1:100), rabbit anti-C3c (DAKO Denmark A/S ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C1q (DAKO Denmark A/S, Glostrup, Denmark; 1:100), goat anti-C5 (Cappel ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by HRP-conjugated rabbit anti-rat (1:5000, P0450, Dako). For detection of Btn2-HA ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-von Willebrand factor (rabbit polyclonal, Dako # A0082, diluted 1:100), anti-Pax7 (mouse monoclonal ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-Glial Fibrillary Acidic protein (GFAP) (Z0334, DAKO, 1:500); rabbit anti S100 (Z0311 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the secondary polyclonal swine anti-rabbit immunoglobulins/HRP (DAKO P0399) and polyclonal rabbit anti-mouse immunoglobulins/HRP (DAKO P0161) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (Dako,1:600), mouse monoclonal anti-GFAP (Cell Signaling ...
-
bioRxiv - Immunology 2021Quote: ... followed by the EnVision+ System-HRP Labelled Polymer Anti-Rabbit (Agilent). For visualization ...
-
bioRxiv - Neuroscience 2021Quote: ... or goat anti-Mouse Immunoglobulins/HRP (1:10000, Agilent Dako P0447). Proteins were detected by the luminol-based enhanced chemiluminescence method (SuperSignal™ West Femto Maximum Sensitivity Substrate or SuperSignal™ West Dura Extended Duration Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... or goat anti-Mouse Immunoglobulins/HRP (1:10000, Agilent Dako P0447). Proteins were detected by the luminol-based enhanced chemiluminescence method (SuperSignal™ West Femto Maximum Sensitivity Substrate or SuperSignal™ West Dura Extended Duration Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-Glial Fibrillary Acidic Protein (GFAP; Dako, z0334; 1:500), Rabbit anti-mouse NeuN (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by secondary anti-mouse IgG conjugated with horseradish peroxidase (DAKO). The immunoreactions were visualized by ECL chemiluminescence system (Amersham ...
-
bioRxiv - Immunology 2020Quote: ... and mouse anti-Ki67 (MIB-1, Agilent DAKO, Santa Clara, CA) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... and mouse anti-Ki67 (MIB-1, Agilent DAKO, Santa Clara, CA) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dako EnVision+ System-HRP Labelled Polymer anti-Rabbit (K4002) from Dako. CNP-22 (4229-v ...
-
bioRxiv - Cell Biology 2019Quote: ... citrate buffer pH 6.0 antigen retrieval) and anti-Ki-67 (Dako; clone IR626 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-mouse IgG–conjugated HRP (1:1000 dilution; P0447, Dako) was used as the secondary antibody.