Labshake search
Citations for Agilent :
3651 - 3700 of 4217 citations for Mouse Anti Dengue Virus Serotype 2 NS1 Antibody CM435 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The signal was visualized with HRP-labeled anti-rabbit polymer (DAKO) and DAB (DAKO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... Polyclonal Rabbit Anti-Glial Fibrillary Acidic Protein was purchased from Agilent Dako (Z033401-2) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and anti-Ki67 (MIB-1, Agilent Technologies, Santa Clara, CA, USA) with a monoclonal mouse antibody used at a 1:50 dilution ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C3c (DAKO Denmark A/S, Glostrup, Denmark; 1:100) were diluted in PBS + 0.1% Tween20 (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C3d (DAKO Denmark A/S, Glostrup, Denmark; 1:100), rabbit anti-C3c (DAKO Denmark A/S ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-C1q (DAKO Denmark A/S, Glostrup, Denmark; 1:100), goat anti-C5 (Cappel ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by HRP-conjugated rabbit anti-rat (1:5000, P0450, Dako). For detection of Btn2-HA ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-von Willebrand factor (rabbit polyclonal, Dako # A0082, diluted 1:100), anti-Pax7 (mouse monoclonal ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-Glial Fibrillary Acidic protein (GFAP) (Z0334, DAKO, 1:500); rabbit anti S100 (Z0311 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the secondary polyclonal swine anti-rabbit immunoglobulins/HRP (DAKO P0399) and polyclonal rabbit anti-mouse immunoglobulins/HRP (DAKO P0161) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (Dako,1:600), mouse monoclonal anti-GFAP (Cell Signaling ...
-
bioRxiv - Immunology 2021Quote: ... followed by the EnVision+ System-HRP Labelled Polymer Anti-Rabbit (Agilent). For visualization ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-Glial Fibrillary Acidic Protein (GFAP; Dako, z0334; 1:500), Rabbit anti-mouse NeuN (Millipore ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were incubated with human-specific anti-Ki67 (DAKO, cat# M7240) or human specific anti-ClCaspase3 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2019Quote: ... MSH6 (Monoclonal Rabbit Anti-Human; Clone EP49, dilution 1 : 1000 Dako) PMS2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dako EnVision+ System-HRP Labelled Polymer anti-Rabbit (K4002) from Dako. CNP-22 (4229-v ...
-
bioRxiv - Cell Biology 2019Quote: ... citrate buffer pH 6.0 antigen retrieval) and anti-Ki-67 (Dako; clone IR626 ...
-
bioRxiv - Microbiology 2020Quote: ... and horseradish peroxidase labeled goat-anti-rabbit IgG (P0448, DAKO, Agilent Technologies Netherlands B.V ...
-
bioRxiv - Neuroscience 2020Quote: ... and anti-tau (1:4000, DAKO Agilent, Santa Clara, CA, USA). The cultures were then washed three times with PBS and then incubated for two hours with the following fluorescent secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:6000 anti-total tau (DAKO Agilent, Santa Clara, CA, USA) and 1:10000 anti-b-actin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... and anti-tau (1:4000, DAKO Agilent, Santa Clara, CA, USA). The cultures were then washed three times with PBS and then incubated for two hours with the following fluorescent secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:6000 anti-total tau (DAKO Agilent, Santa Clara, CA, USA) and 1:10000 anti-b-actin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... or anti-GFAP (Rabbit, Dako, Agilent, Santa Clara, CA, USA, Z0334), anti-AR (Rabbit ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... or anti-GFAP (Rabbit, Dako, Agilent, Santa Clara, CA, USA, Z0334), anti-AR (Rabbit ...
-
bioRxiv - Immunology 2021Quote: ... Horse-radish peroxidase-conjugated rabbit anti-goat was obtained from Agilent Dako (USA) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-smooth muscle alpha-actin (α-SMA - Dako GA611, 1:100), anti-ACE2 (Merck SAB3500346 ...
-
bioRxiv - Cell Biology 2021Quote: Cells were immunostained for GFAP (rabbit anti-GFAP, 1:300, Dako) and fibronectin (rabbit anti-fibronectin antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...
-
bioRxiv - Genetics 2022Quote: ... and anti-PGR (1:200, A0098, Agilent Technologies, Santa Clara, CA). For IHC ...
-
bioRxiv - Physiology 2022Quote: ... and polyclonal goat anti-rabbit immunoglobulin/HRP (1:1000, DAKO Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-GFAP (1:500, Dako, Santa Clara, CA, USA, Z0334), mouse anti-GFAP (1:500 ...