Labshake search
Citations for Agilent :
3551 - 3600 of 8613 citations for Testosterone ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... RNA integrity was determined using the Bioanalyzer RNA 6000 Nano assay kit (Agilent, 5067-1511). RNA library construction was performed with the TruSeq RNA Library Prep Kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used to determine RNA integrity using High Sensitivity RNA Screentape analysis kit (Agilent, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Library fragment size was determined using a BioAnalyzer (RNA 6000 Nano Kit; Agilent, CA, USA) and concentration was quantified on a Qubit (Qubit High Sensitivity RNA Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting size-selected libraries were analyzed with the Agilent High Sensitivity DNA Kit (Agilent) and sequenced with the NovaSeq 6000 S1 SE 75 (HEK293T samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... quality was assessed on a Bioanalyzer 2100 with the RNA 6000 Pico Assay kit (Agilent). cDNAs were constructed using the SMARTer v4 Ultra low Input RNA kit (Takara) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for integrity using the RNA 6000 Nano Kit on the 2100 Bioanalyzer (Agilent Technologies). RNA was treated using the TURBO DNA-free™ Kit (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... quality of libraries was assessed using a high sensitivity DNA kit on a Bioanalyzer (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and size distribution was assessed with a 2100 Bioanalyzer High Sensitivity DNA Analysis Kit (Agilent). Multiplexed bulk human placental libraries were sequenced on the NextSeq500 platform using 150 cycle single-end protocol generating a total of 36.9 to 70.9 million 101bp reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... The material was then assessed with a Bioanalyzer RNA 6000 Pico kit (Agilent Technologies, USA). 8μl of the eluted 12μl aRNA was transferred into a new 96-well PCR plate (Eppendorf ...
-
bioRxiv - Genomics 2020Quote: ... The libraries were quality controlled on Fragment Analyzer [using DNA7500 kit (5067-1506, Agilent Technologies). The library yields were determined based on 200-800-bp range.
-
bioRxiv - Immunology 2021Quote: Deletions or point mutations were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) or In-Fusion HD Cloning Kit.
-
bioRxiv - Immunology 2021Quote: ... RNA quality was evaluated with Bioanalyzer RNA pico kit (Agilent Technologies Inc, Santa Clara, CA). Poly(A)-selected RNA was amplified using the SMARTseq2 protocol (Clontech – Picelli et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Molecular Biology 2021Quote: RNA quailty was studied with BioAnalyzer RNA analysis (5067-1511, Agilent, RNA 6000 nano kit). Small RNA libraries were produced with NEBNext Multiplex SmallRNA Library Prep Kit for Illumina (E7560S ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Concentration of each library was determined using either the qPCR Quantification Kit for Illumina (Agilent) or the KAPA Library Quantification Kit for Illumina (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the fragment size was checked using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies). Libraries were pooled equimolarily and sequenced on the Illumina NextSeq platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples quality assessment/size was validated by Bioanalyzer DNA-High sensitivity kit (Agilent # 5067-4626).
-
bioRxiv - Microbiology 2019Quote: ... and libraries were prepared using the SureSelect Automated Library Prep Kit (Agilent, Santa Clara, USA). Index tagged samples were amplified using KAPA HiFi DNA polymerase ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGO2Y393F mutant construct was generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) from the FH-AGO2 plasmid described above using the primers hAGO2_Y393F_Fwd 5’AAATTCACGGACGAATGGATCTGTGTTGAAACTTGCAC3’ and hAGO2_Y393F_Rev 5’GTGCAAGTTTCAACACAGATCCATTCGTCCGTGAATTT3’ ...
-
bioRxiv - Plant Biology 2019Quote: ... The probes were prepared using Prime-It® Rm T Random Primer Labeling kit (Stratagene). The probe for AtMIOX4:pBIB-Kan was amplified with npt-II forward (5’-AGA GGC TAT TCG GCT ATG AC-3’ ...
-
bioRxiv - Neuroscience 2019Quote: ... and RNA quality was assessed using the Bioanalyser (Agilent RNA 6000 Pico kit; #5067-1513). The libraries were prepared using 0.5-2 ng of non-cerebellum microglia RNA samples with RIN value ≥ 7 and cerebellar microglia with RIN value ≥ 6 ...
-
bioRxiv - Genomics 2019Quote: ... and library qualification and quantification reagent using Bioanalyzer High Sensitivity Kit was purchased from Agilent. NextSeq 500/550 kit for short read sequencing was purchased from Illumina.
-
bioRxiv - Biochemistry 2019Quote: Site-specific mutagenesis was performed using the QuikChange™ Site-Directed Mutagenesis Kit from Stratagene. All mutants were confirmed by sequencing of plasmid DNA at Eurofins MWG Operon (Ebersberg ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The cDNA libraries were prepared using SureSelect Strand Specific RNA Library Preparation Kit (Agilent Technologies) and RNA and cDNA qualities were assessed using BioAnalyzer Kits (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Site mutagenesis of RBOHC and RBOHD was performed with a QuickChange Kit (Agilent Technologies; 210518). The indicated proteins were incubated in protein kinase assay buffer (20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Microbiology 2021Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... Modifications of these plasmids were made using the QuikChange Lightning site-directed mutagenesis kit (Agilent). The C-termini were tagged with mGFP or mCherry to facilitate protein localization ...
-
bioRxiv - Cell Biology 2020Quote: ... and R784A were introduced into pHalo-NM2C using QuikChange site-directed mutagenesis kit (200524; Agilent).
-
bioRxiv - Genomics 2021Quote: ... WGS libraries were quality controlled with the high-sensitivity DNA kit on the Bioanalyzer (Agilent), selecting for size distributions of 300bp to 1kb and concentrations over 1 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using SYBR Green One-Step (Kit# 600825, Agilent, Santa Clara, CA). qRT-PCR data were analyzed using the Sequence Detection System software (SDS Version 2.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality check was performed using a Fragment Analyzer (HS NGS Fragment kit, Agilent, DNF-474). Further ...
-
bioRxiv - Cancer Biology 2020Quote: ... Labeled cRNA were prepared from total RNA using the Agilent’s Quick Amp Labeling Kit (Agilent). Following fragmentation ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... RNA quality was then assessed using a eukaryote total RNA Nano 6000 Kit (Agilent Technologies) prior to high depth RNA sequencing or microarray analysis and qRT-PCR.
-
bioRxiv - Neuroscience 2021Quote: ... Mutations were introduced by use of the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer using the Agilent QuikChange Primer Design tool for primer design.
-
bioRxiv - Neuroscience 2021Quote: ... Final RNA quality and integrity were assayed using the DNA 12000 kit on Bioanalyzer (Agilent). Further ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality of RNA extracts was assessed on the Bioanalyser using the RNA pico kit (Agilent). Samples with RIN value higher than 8 were processed using the NEBNext poly(A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The quality of the libraries was assessed with the Bioanalyzer High Sensitivity DNA kit (Agilent). The libraries were quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: Libraries of ProQ mutants were generated by using GeneMorph II EZClone Domain Mutagenesis Kit (Agilent). As template ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were tested for mycoplasma using the PCR based mycoplasma detection kit (Agilent).
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries’ quality and quantity were verified with a High-Sensitivity DNA Kit (Agilent Technologies, USA) on a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... using Agilent DNA screentape D1000 kit on a TapeStation (Agilent Technologies, Santa Clara, CA, USA), the hybridization steps were performed using exome capture probes and streptavidin coated beads ...
-
bioRxiv - Cell Biology 2021Quote: ... OCR and ECAR were measured using Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies). 1 × 104 cells/well were plated onto 7 μg/mL Poly-D-Lysine coated (Ruhanen et al ...
-
bioRxiv - Cell Biology 2021Quote: ... product size distribution and quantity were assessed on a Bioanalyzer High Sensitvity DNA Kit (Agilent). The amplified cDNA (200 ng ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Biochemistry 2020Quote: ... All point mutations were generated by the Quick Change site-directed mutagenesis kit (Agilent, CA) and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cellular OCR and ECAR were analyzed using the Mito Stress Test Kit (Agilent Technologies, 103015) at the following drug concentrations ...
-
bioRxiv - Cell Biology 2021Quote: ... The latter was further subjected to site-directed mutagenesis using QuikChange Lightning kits (Agilent Inc.).
-
bioRxiv - Microbiology 2020Quote: ... and an Agilent 2100 Bioanalyzer with an RNA 6000 Nano LabChip kit (Agilent Technologies, Ltd.). All the samples displayed a 260/280 ratio greater than 2.0 and RNA integrity numbers (RIN ...