Labshake search
Citations for Agilent :
3551 - 3600 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the slides were washed with Gene Expression Wash Buffer Kit (Agilent, Santa Clara, CA, USA) and measured using an Agilent Scanner G2565BA ...
-
bioRxiv - Cell Biology 2023Quote: ... Multi site-directed mutagenesis was performed by QuikChange Multi site-directed Mutagenesis Kit (Agilent 200513). Successful cloning was confirmed by sequencing for all constructs.
-
bioRxiv - Microbiology 2023Quote: ... Equimolar concentrations were pooled and quality-controlled using a Bioanalyzer with DNA 1000 Kit (Agilent) before sequencing using the MiSeq platform (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... RNA purity and integrity were determined with Agilent RNA 6000 Pico Kit (Agilent, 5067-1513) on Bioanalyser 2100 (Agilent).
-
bioRxiv - Genetics 2023Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... An Agilent 2100 Bio analyzer (Agilent RNA 6000 Nano Kit) (Agilent Technologies Inc., United States) was used for RNA quality control ...
-
bioRxiv - Pathology 2023Quote: ... Quality of the libraries was determined using an Agilent High Sensitivity DNA kit (Agilent Technologies). Finalized libraries were sequenced on a Novaseq6000 sequencing platform (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... quantified with the AccuClear Ultra High Sensitivity dsDNA Quantitation kit and analyzed on BioAnalyzer (Agilent). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis was carried out using a QuickChange II site-directed mutagenesis Kit (Agilent) according to the manufacture’s recommendation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The E549A mutation was introduced using the QuikChange Lightning kit (Agilent, Santa Clara, CA, USA). All cloned constructs and introduced modifications were verified by DNA sequencing ...
-
bioRxiv - Immunology 2023Quote: ... 2µg amplified cDNA was Cy-labeled using the SureTag DNA labeling kit (Agilent, Waldbronn, Germany). The Cy5-labeled cDNA was hybridized overnight to 8 x 60K 60mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control of total RNA was performed using the RNA 6000 Pico Kit (Agilent Bioanalyzer) yielding in RIN values of 6.3 and higher ...
-
bioRxiv - Biophysics 2023Quote: ... Cell transfection and virus production was performed using the MBS Mammalian Transfection Kit (Agilent Technologies). The infectious supernatant was collected 72 hours after transfection and filtered onto CHO-K1 target cells for transduction ...
-
bioRxiv - Biochemistry 2023Quote: ... site-directed mutagenesis using the QuikChange II XL kit (Agilent Technologies, Inc., Santa Clara, CA). For each targeted codon ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pooled cDNA libraries were checked using a High Sensitivity DNA Kit on a Bioanalyzer (Agilent) or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp ...
-
bioRxiv - Cell Biology 2023Quote: GFP-TRIM5α and myc-TBK1 were mutated using a site-directed mutagenesis kit (Agilent, 210518). All plasmid constructs generated in this study were validated by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Myc-TRIM27 W184A/F186A/L189A was mutated with Quickchange II site-directed mutagenesis kit (Agilent). pDONR221-AZI2/NAP1 was synthesized by Invitrogen GeneArt services (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Relevant mutations were introduced with the QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies) to generate vectors encoding R1446C/Y1503F ...
-
bioRxiv - Cancer Biology 2023Quote: ... We next used the SureSelect XT HS reagent Kits (5190-9685 and 5191-6686, Agilent) and the SureSelect XT HS Human All Exon V7 target-enrichment probes (5191-4028 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA from each experimental condition was isolated by using Absolutely Rna Nanoperp kit (Agilent technologies). CDNA was generated with PrimeScript kit (Takara) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Library quality was assessed on the Bioanalyser using the Agilent High Sensitivity DNA kit (Agilent). Libraries were sequenced on the Illumina NextSeq 2000 sequencing platform according to 10x manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Site-directed mutagenesis was performed using the QuikChange kit (Agilent Technologies, Santa Clara, CA, USA). For L ...
-
bioRxiv - Biochemistry 2024Quote: ... Site-directed mutagenesis was performed using a QuikChange site-directed mutagenesis kit (Agilent, CA, USA) or KOD -Plus- Mutagenesis Kit (Toyobo ...
-
bioRxiv - Molecular Biology 2024Quote: ... Site-directed mutagenesis was carried out using Quikchange Lightning Site-Directed Mutagenesis Kit (Agilent, # 210518) (primers in Table S2) ...
-
bioRxiv - Immunology 2024Quote: PCR was carried out with an error-prone polymerase (Agilent, GeneMorph II Random Mutagenesis Kit) to create a randomly mutagenized GP38 library as previously described79.
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting size-selected libraries were analyzed with the Agilent High Sensitivity DNA Kit (Agilent). Each library was mixed in equimolar proportion for sequencing with the NovaSeq 6000 SP PE.
-
bioRxiv - Genomics 2023Quote: ... and visualized using an Agilent DNA 12000 kit on an Agilent 2100 Bioanalyzer (Agilent Technologies) (Figure 2) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality was determined used the Agilent DNA 1000 Kit on a 2100 BioAnalyzer (Agilent). Validated libraries were subjected to 75-bp single-end sequencing on the Illumina NextSeq 500 platform.
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 x 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutations were introduced using the M27-QC primers and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent; 210513). Plasmids were integrated via dual transfection with pCAG-SpCas9-GFP-U6-gRNA (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... The total RNA quality was checked with Bioanalyzer (Agilent, RNA 6000 Nano kit, 5067-1511). Small RNA library preparation started with 1ug high quality total RNA ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770 ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 × 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Bioengineering 2022Quote: ... Alanine mutants of LRP6 ectodomain were generated using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Point mutations were created using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with either the pBRA SP-Tlde1WT plasmid or Tlde1WT pET28b plasmid used as template ...
-
bioRxiv - Cell Biology 2022Quote: ... The R73K mutation was introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The primer for mutagenesis (AATGCGAGCTATCTTTAATCAAGAAAGTTCCTTCTGGTGCC ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA fragments were tested on a 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was checked on the Agilent TapeStation using the RNA Screen Tape kit (Agilent). Total RNA (500 ng ...
-
bioRxiv - Immunology 2022Quote: The Seahorse XF Cell Mito Stress Test Kit (Agilent, Santa Clara, CA; Catalog #103015-100) was run on a Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... samples were run with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA) on the Agilent 2100 Bioanalyzer system (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) to include D614G (ancestral D164G ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the fragmented RNA was evaluated by the Bioanalyzer pico kit (Agilent Technologies, USA). ~20ng/μl of mechanical extracted RNA were added on a 16S surface probe coated QC array in an in situ cDNA reaction ...
-
bioRxiv - Genetics 2022Quote: ... The primers used for mutagenesis using the Quickchange Lightning mutagenesis kit (Stratagene, La Jolla, CA) are as follows:
-
bioRxiv - Immunology 2022Quote: ... The quality of extracted RNA was assessed using Bioanalyzer and RNA 6000 Nano Kit (Agilent). Gene expression levels were obtained using Human Clariom S arrays on GeneTitan MC Instrument International (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... Silent mutations on TLN1 were generated with the QuikChange site-directed mutagenesis kit (Agilent Technologies) to make our construct resistant against the previously described siRNA specific for TLN1 (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA quality was further assessed using RNA 6000 Pico Kit and Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... and V3306F were introduced using the Quick-change II Site-Directed Mutagenesis Kit (Agilent, UK).