Labshake search
Citations for Agilent :
301 - 350 of 6621 citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... were quantified in real time using a Seahorse XFe Extracellular Flux Analyser (Seahorse Bioscience, Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... qRT-PCR was conducted using the Stratagene Mx3005P detection system (Agilent Technologies) and GoTaq qPCR mix (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... Transcripts were quantified using the AccuScript high fidelity RT-PCR system (Agilent) according the manufactures instructions ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per the manufacturer’s instructions using primers ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a standard curve was constructed via RT-PCR (Agilent, Santa Clara, CA) with copy numbers of the SIV gene ranging from 4.25 x 109 copies to 85 copies using serial dilutions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The relative transcript accumulation of NaTPS25 was measured using RT-PCR on a Stratagene MX3005P PCR cycler (Stratagene). The elongation factor-1A gene ...
-
bioRxiv - Microbiology 2020Quote: were performed in triplicate in white 96-well PCR plates (4titude) using a RT-PCR machine (MX3005P, Agilent) with excitation and emission filters of 492 and 585nm ...
-
bioRxiv - Cell Biology 2020Quote: ... The energy flux data in real time was determined using Wave 2.6 software (Agilent Technologies).
-
bioRxiv - Neuroscience 2019Quote: ... Real-time verification of the DBS stimulation parameters was monitored using a digital oscilloscope (Agilent 54622D oscilloscope ...
-
bioRxiv - Cell Biology 2021Quote: Real-time measurements of OCR were performed using the Seahorse XFe96 Extracellular Flux Analyzer (Agilent) with Seahorse XF Cell Mito Stress Test Kit (103015-100) ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time mitochondrial respiration was measured using the Seahorse XFe96 Extracellular Flux Analyzer (Agilent Technologies) and Seahorse XF Cell Mito Stress Test kit per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... according to supplier’s instructions in a Mx3000 Real-Time Thermocycler (Stratagene, San Diego, CA, USA). In a 40 cycles PCR reaction ...
-
bioRxiv - Pathology 2020Quote: ... The threshold cycle (Ct) was determined using an Mx3005P Real-Time QPCR System (Agilent Technologies). The mRNA expression of target genes was calculated using the ΔΔct method.
-
bioRxiv - Physiology 2021Quote: ... except for the instrument that was an AriaMx Real-Time qPCR System (Agilent, California, US). The relative gene expression was calculated using the 2 -ΔΔCt method (75).
-
bioRxiv - Cancer Biology 2022Quote: Proliferation of cells in real time was monitored using the xCELLigence RTCA SP instrument (Agilent). 2500-10,000 cells per well were seeded at the start of the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... The E-plate was engaged into the xCELLigence Real Time Cell Analysis (RTCA) Instrument (Agilent) and background measurement of the wells plus growth media was recorded before adding cells in 150 μL of media for each SLC condition (5 x 103 cells/well) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were quantified in real time using a Seahorse XFe Extracellular Flux Analyser (Seahorse Bioscience, Agilent, In Vitro Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cell viability was monitored using the xCELLigence MP Real-Time Cell Analysis (RTCA) system (Agilent) as previously described [14] ...
-
bioRxiv - Immunology 2024Quote: Adherence and proliferation were measured with an xCELLigence real-time cell analysis instrument from Agilent. For baseline impedance measurements of the wells ...
-
bioRxiv - Cell Biology 2024Quote: Cell impedance was measured using a Real Time Cell Analyzer (RTCA; Agilent, Santa Clara, CA). Before adding 30,000 cells to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... Basal ATP production rates were calculated using the Seahorse XF Real-Time ATP Rate Assay Kit Report Generator (Wave Desktop Software, Agilent Technologies, Cedar Creek, TX). Briefly ...
-
bioRxiv - Immunology 2020Quote: mRNA in total RNA was converted to cDNAby using AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA) following the method described elsewhere (17) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was carried out with SYBR Green PCR master mix (Agilent, 600882) on cDNA (diluted 1:5 in water) ...
-
bioRxiv - Physiology 2019Quote: ... followed by detection using the CSA-II kit (DAKO). Insulin was detected with guinea pig anti-insulin antibody (DAKO ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Bioengineering 2020Quote: One-step Brilliant II RT-qPCR core kit (Agilent) was used for quantitative analysis of extracted HIV RNA ...
-
bioRxiv - Cell Biology 2021Quote: Real-time cell analysis (RTCA) of cell proliferation was monitored using the xCELLigence DP system (Agilent). Before cell seeding ...
-
bioRxiv - Cancer Biology 2022Quote: ... Data analysis was performed using the XF Real-Time ATP Rate Assay Report Generator (Seahorse Bioscience).
-
bioRxiv - Cell Biology 2023Quote: Real-time oxygen consumption rate (OCR) was measured using a Seahorse XF96 Extracellular Flux Analyzer (Agilent) and a Mito Stress Test Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT-PCR was performed using the Mx3000P QPCR System (Agilent Technologies, Lexington, MA) with incubation parameters of 2 min at 50°C ...
-
bioRxiv - Immunology 2023Quote: RT-PCR product was QC’ed using the DNA high sensitivity Bioanalyzer Chip (Agilent Technologies). Sample preparation for Illumina deep sequencing was done using the KAPA HyperPrep Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction was visualized with the EnVision Detection Kit (DAKO) using diaminobenzidine chromogen as substrate ...
-
bioRxiv - Pathology 2023Quote: ... The reaction was visualized with the EnVision Detection Kit (DAKO) using diaminobenzidine chromogen as substrate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mutations in the miR-204 binding sites were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the mutated sequences were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: cDNA was synthesized from the previously extracted RNA of mice colon tissue by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random 9mer primers ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Physiology 2023Quote: ... followed by Vectastain Elite ABC HRP detection kit (Vector PK-6100) and detection with DAB (Agilent Technologies K346811-2). Cell death and DNA fragmentation were detected with a TUNEL In Situ Cell Death Detection Kit (Roche ...
-
bioRxiv - Cell Biology 2021Quote: Real time directional EC migration was monitored with an xCELLigence RTCA DP instrument (ACEA Biosciences/Agilent Technologies) as previously described (Camillo et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... and real-time qPCR was performed using an Mx3000P Multiplex qPCR system (Stratagene, La Jolla, CA, USA) as described before (Raineri et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were measured from live cells in real time using Seahorse Extracellular Flux (XF) 24 Analyzer (Agilent Technology). OCR and ECAR were measured simultaneously ...
-
bioRxiv - Cell Biology 2023Quote: ... Seahorse XF Cell Mitostress test and Real-Time ATP Rate Assays (Agilent Technologies, Santa Clara, CA, USA) were used to evaluate mitochondrial function ...
-
bioRxiv - Neuroscience 2023Quote: ... ATP production from FO slices was measured using the Seahorse XF Real-Time ATP Rate Assay (Agilent) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Systems Biology 2023Quote: ... Both OCR and ECAR were subsequently measured in real time using XF96 extracellular flux analyzer (Seahorse Bioscience). The optimized concentration of compounds for mito-stress assay were 1.5 μM of oligomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein expression was visualised using DAB (Dako Real Envision kit) for 3-5 minutes ...