Labshake search
Citations for Agilent :
301 - 350 of 6344 citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Neuroscience 2023Quote: Sensory neurons were seeded into Seahorse cell plates (Agilent, Santa Clara, CA, USA) and cultivated for six weeks ...
-
bioRxiv - Microbiology 2023Quote: ... and OD600 readings were taken using a Synergy LX plate reader (Agilent BioTek).
-
bioRxiv - Microbiology 2023Quote: ... and OD600 readings were taken using a Synergy LX plate reader (Agilent BioTek).
-
bioRxiv - Physiology 2023Quote: PAEC were plated in a Cell Tak-coated XF24 cell culture plate (Agilent) in XF assay media pH 7.4 (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA quantity was determined using a BioTek Synergy H1 plate reader (Agilent Technologies), and PCR reactions were performed using Acomys-specific primers for the target SrY ...
-
bioRxiv - Cell Biology 2023Quote: ... 15,000 cells/well were seeded in a 96-well E-plate (Agilent, 5232368001)47 containing gold microelectrodes fused to the bottom surface of the well plate ...
-
bioRxiv - Systems Biology 2024Quote: ... All measurements were read with a BioTek Synergy HTX Multimode Plate Reader (Agilent). All samples from a single tissue-type were measured on the same plate ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Mean optical density was read on a Synergy H1 plate reader (Agilent BioTek), and corticosterone concentrations were determined in ug/mL based on a standard curve.
-
bioRxiv - Microbiology 2024Quote: ... and optical density measurements at 600nm in a plate reader (Epoch 2, Agilent) for 20h ...
-
bioRxiv - Microbiology 2024Quote: ... The 96-well plates were placed in Biotek Epoch 2 Microplate Spectrophotometer (Agilent). OD600 measurements were made for 24 hours in 20-minute intervals and the OD600 values were plotted in GraphPad Prism software.
-
bioRxiv - Neuroscience 2024Quote: Real-time oxygen consumption rate (OCR) was measured using XFe96 plate (Seahorse Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and monitored with a BioTek Synergy HTX plate reader (Agilent, Santa Clara, CA). Intrinsic fluorescence from TA analogs did not interfere with monitoring reaction progress by the increase in ThT fluorescence (λex = 440 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a skirted PCR plate to facilitate automation (Agilent Bravo liquid handling system). Library pools then underwent qPCR quantification and libraries were adjusted to a concentration of 2nM ...
-
bioRxiv - Microbiology 2024Quote: ... Luminescence was detected a BioTek Synergy Neo2 plate reader (Agilent, Santa Clara, CA). The amount of ATP was calculated and normalized to cell count.
-
bioRxiv - Immunology 2024Quote: ... CD14+ monocytes were seeded onto XFe24 cell culture plates (Seahorse Bioscience, Lexington, MA) with RPMI medium with 10% HS ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... The Telomere PNA Kit/FITC kit from Dako (Agilent) was used to estimate Telomere length signal in samples ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were seeded in triplicate in XF96 96-well cell culture plate (Seahorse Bioscience) in a volume of 80 μl/well in DMEM complete medium at a density of 15,000/well (HEK293) ...
-
bioRxiv - Immunology 2021Quote: ... plates were transferred to the Seahorse XF96 Flux Analyzer (Agilent, Santa Clara, CA, USA) to record cellular oxygen consumption rates (OCR ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA and RNA concentrations were measured using Synergy LX reader with Take3Trio plate (Agilent) in 2µL volume.
-
bioRxiv - Molecular Biology 2020Quote: ... Differentiated BMDMs were seeded at 0.25×106 cells/well in XF24-well plates (Agilent) and polarized for M0 ...
-
bioRxiv - Cancer Biology 2022Quote: ... coated Seahorse XF96 plates in 200 μL XF Assay Medium (Modified DMEM, Seahorse Bioscience), respectively ...
-
bioRxiv - Physiology 2020Quote: C2C12 myotubes were cultured on eight-well Seahorse culture plates (Agilent, Santa Clara, USA). 1.0 × 104 cells were plated into each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 μl supernatant was transferred into 96-well plate and read on YSI (Agilent). The number of cells in the 12-well plate was counted for normalization.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... coated Seahorse XF96 plates in 200 μL XF Assay Medium (Modified DMEM, Seahorse Bioscience). For OCR measurements ...
-
bioRxiv - Physiology 2023Quote: ... The 540 nm absorbance was measured using a Synergy H1 plate reader (Agilent BioTek), and glycogen levels were calculated based on a glucose standard curve after subtracting the absorbance measured for free glucose in the untreated samples from the absorbance of the samples digested with amyloglucosidase ...
-
bioRxiv - Physiology 2023Quote: ... Absorbance at 492 nm was measured using a plate reader (Synergy H1, Agilent BioTek). The TAG content was determined by subtracting free glycerol from TAG ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was recorded for 1 h on a Biotek Synergy HTX plate reader (Agilent) with excitation and emission filters of wavelength 485/20 and 528/20 nm ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluorescence of plasma samples was directly measured using a Take 3 Microvolume Plate (Agilent), measured using an Agilent Cytation 7 (Excitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... The absorbance was taken at 450 nm using the Epoch Plate Reader (Agilent BioTek).
-
bioRxiv - Cell Biology 2023Quote: Chemotaxis assays were performed using Real-Time Cell Analysis (RTCA) CIM-16 plates (Agilent). The lower chamber contained conditioned medium as the chemoattractant or DMEM supplemented with 0.5% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were seeded (8000 cells/well) in a 96-well RTCA E-plate (Agilent) in 4 replicates per condition ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fluorescence intensity was measured on a Synergy HTX multimode plate reader (Agilent BioTek) using Gen5 software at an excitation wavelength of 485/20nm and emission wavelength of 528/20nm with read height 8.5mm ...
-
bioRxiv - Biophysics 2023Quote: FRET experiments were performed in 96-well plates using an Mx3005P qPCR machine (Agilent) equipped with FAM filters (λex = 492 nm ...
-
bioRxiv - Microbiology 2023Quote: ... and fluorescence was read in a microtiter plate reader (Synergy HTX Multimode Reader; Agilent Biotek or EnSpire Multimode Plate Reader ...
-
bioRxiv - Biophysics 2023Quote: ... Plates were heat sealed with a PlateLoc Thermal Microplate Sealer (Agilent, Santa Clara, CA) and stored at -20°C prior to use ...
-
bioRxiv - Genetics 2023Quote: ... Uncovered NGM-lite plates were then placed in a Stratalinker 2400 UV Crosslinker (Stratagene) and irradiated with wavelength 254 nm light at 400J/m2 ...
-
bioRxiv - Physiology 2023Quote: ... 1250 live cardiomyocytes/well were plated to a 96-well plate (Agilent #101085-004) coated with 50µg/mL laminin (ThermoFisher #23017-015 ...
-
bioRxiv - Microbiology 2023Quote: ... Growth curve experiments were performed in 96-well plate format using a BioTek (Agilent) plate reader set to 37°C continuous shaking ...
-
bioRxiv - Bioengineering 2023Quote: ... The assay plate was then placed in the Seahorse instrument (Agilent Seahorse XF Pro) to measure the oxygen consumption rate (OCR ...
-
bioRxiv - Bioengineering 2023Quote: ... The purified RNA was quantified using a Take3 microvolume plate (Synergy HTX, Agilent, USA). The RNA was reverse transcribed using the RevertAidTM Kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was read using a plate reader (BioTek Synergy, Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Cell Biology 2023Quote: Myoblasts were cultured directly on the Seahorse assay plates (Seahorse XFe24 FluxPak, Agilent, USA) with 20,000 cells/well ...
-
bioRxiv - Cancer Biology 2024Quote: Mahlavu and Huh7 cells were plated into E-96 plates (Agilent, cat. no:5232368001), 1500-2500 cells/wells ...
-
bioRxiv - Genomics 2024Quote: ... the plate was exposed to 365nm UVA light (Stratagene UV Stratalinker 2400, power 5.0) for 5 minutes followed by a 5-minute incubation in ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...