Labshake search
Citations for Agilent :
301 - 350 of 6160 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... using a AriaMx Real-Time PCR system (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... using a AriaMx Real-Time PCR system (Agilent). The relative quantitation of target mRNA levels was performed by using the 2-ΔΔCT method ...
-
bioRxiv - Genomics 2020Quote: ... PCR3 products were PCR-purified and Tapestation (Agilent) was used to quantify and pool samples for NGS.
-
bioRxiv - Genomics 2020Quote: ... An AriaMx Real-time PCR System (Agilent Technologies) was used for quantification of RNA levels and the X0 method was used for calculations of relative RNA levels (76 ...
-
bioRxiv - Microbiology 2021Quote: ... and an AriaMx Real-Time PCR system (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: ... An AriaMx Real-time PCR System (Agilent Technologies) was used for quantification of RNA levels and the X0 method was used for calculations of relative RNA levels (Thomsen ...
-
bioRxiv - Cancer Biology 2021Quote: ... on an MX3000P real-time PCR machine (Stratagene), normalising the amount of target gene to the endogenous level of TBP ...
-
bioRxiv - Neuroscience 2020Quote: ... on a Mx3000P real time PCR system (Stratagene). Levels of enrichment after ChIP were calculated using the comparative cycle threshold method (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... in the AriaMx Realtime PCR System (Agilent Technologies) as previously described (Arsova et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitive PCR was performed using the AriaMX (Agilent) with a 25 µl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations were generated by PCR using Quikchange (Stratagene). SdhA deletions were generated by inverse PCR (Ochman et al. ...
-
bioRxiv - Microbiology 2022Quote: ... on a Mx3005P Real-Time PCR System (Agilent). The 20µl reaction was as follows ...
-
bioRxiv - Microbiology 2022Quote: ... on a Mx3005P Real-Time PCR System (Agilent). The primers used for cDNA amplification were the following ...
-
bioRxiv - Biochemistry 2023Quote: ... and run on AriaMx Real-time PCR (Agilent). The sequences of the primers that were used for the qPCR were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed with Stratagene Mx3005P (Agilent Technologies) with a 0.04 threshold ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4C PCR library efficiencies were confirmed by Agilent Bioanalyzer and libraries were sequenced on a HiSeq4000 in PE150 mode by the MSKCC Genomics Core Facility ...
-
bioRxiv - Microbiology 2023Quote: ... using a AriaMx Real-Time PCR system (Agilent).
-
bioRxiv - Plant Biology 2023Quote: ... The PCR reactions used Pfu Turbo Cx (Agilent), dNTP (Takara Bio) ...
-
bioRxiv - Biochemistry 2023Quote: ... and AriaMX Real-Time PCR machine (Agilent Technologies). Primers used for qPCR are listed in Table S4.
-
bioRxiv - Cell Biology 2024Quote: ... and an AriaMX Real-Time PCR machine (Agilent). Primers used for RTqPCR are listed in Table_2.
-
bioRxiv - Microbiology 2023Quote: ... prior to PCR analysis following manufacturer’s guidelines (Agilent). Gene-specific TaqMan probes (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The Aria Mx Real-Time PCR system (Agilent) was used and the data were extracted from the AriaMx PC software.
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR samples were also analyzed by Agilent 2100 Bioanalyzer system (Agilent Technologies ...
-
bioRxiv - Systems Biology 2023Quote: ... on a AriaMx Real-time PCR System (Agilent) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... mutations were corrected by PCR-based mutagenesis (Stratagene). Secondly ...
-
bioRxiv - Immunology 2022Quote: ... on AriaMx Real-time PCR system (Agilent Technologies). Relative gene expression quantification was normalized with Actin and RPS18 ...
-
bioRxiv - Microbiology 2022Quote: ... using a AriaMx Real-Time PCR system (Agilent). The relative quantitation of target mRNA levels was performed using the 2-ΔΔCT method ...
-
bioRxiv - Molecular Biology 2024Quote: ... An AriaMx Real-time PCR System (Agilent Technologies) was used for quantification of RNA levels and the X0 method was used for calculations of relative RNA levels (Thomsen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... on the Mx3000p Real-Time PCR System (Stratagene).The primers for measure the telomere repeat were (forward ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutations were cloned into the expression vector by polymerase chain reaction (PCR) using a PFUultra II Hotstart PCR Master Mix (Agilent Technologies). The obtained PCR products were subsequently treated with DPNI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA was denatured at 95°C for 5 min in a PCR machine (PTC-200, MJ Research; PCR strip tubes (Agilent 410022)) and then incubated with the biotin capture RNA at 65°C ...
-
bioRxiv - Cell Biology 2021Quote: ... or IRBITKO cells was subjected to PCR amplification (Herculase II Fusion DNA Polymerase and 5X Herculase II PCR Buffer and dNTP (Agilent Techologies) using primers flanking the region targeted by the gRNA ...
-
bioRxiv - Immunology 2020Quote: ... qRT-PCR for mRNA expression was done with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies) as previously described (19) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The qPCR was performed in 20 μl SYBR Green reaction mixture using a Real-time PCR system (Agilent AriaMx Real-time PCR System, Agilent, USA). The ChIP experiments and qPCR were performed in triplicates ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed using a QuantStudio™ 5 Real-Time PCR System with Brilliant II low ROX Sybr Green (Agilent). Reactions were performed with at least 2 technical replicates and 3 biological replicates were performed for each experiment ...
-
bioRxiv - Genetics 2024Quote: The purified RNAs in the 96-well PCR plate (Axygen Scientific, PCR-96-FS-C) were transferred to a 0.3 mL 96-well plate (Agilent, 5043-9313) for hydrolysis in a 40 µL of an enzyme cocktail containing 10 U benzonase (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, US).
-
bioRxiv - Cell Biology 2024Quote: Differentially expressed genes were randomly selected for validation by real-time PCR using the AriaMx real-time PCR system (Agilent Technology, USA) as previously described (23) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and PCR was performed using Herculase II Polymerase (Agilent).
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR was performed on a SureCyler 8800 (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Mx3000P Real Time PCR System (Agilent Technologies) cycler ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Pooled PCR products were purified with AMPure beads (Agilent), and 5ng of the purified pools was barcoded with Fluidigm Access Array barcodes using AccuPrime II (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... on an AriaMX Real Time PCR System (Agilent Technologies). Next generation sequencing was performed by paired-end sequencing of the V4 region using MiSeq Reagent Kit version 3 ...
-
bioRxiv - Bioengineering 2021Quote: ... on an AriaMx Real-Time PCR System (Agilent Technologies). Collagen and BMP-2 mRNA expression data was calculated with the 2-ΔΔCT method using human GAPDH as a reference ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified with TapeStation Systems Software v3.2 (Agilent).
-
bioRxiv - Physiology 2021Quote: ... The MxPro-3000 PCR machine (Stratagene, La Jolla, CA) was used for quantification ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was run on Aria Mx3000 thermocycler (Agilent) with 40 cycles at 60°C annealing temperature for 10 seconds and 72°C elongation for 15 seconds and subsequent melting curve (65°C – 95°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the library was PCR amplified using Herculase II (Agilent) in the 96-well plate to increase the coverage for 22 cycles with the following program (98°C for 5 min ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were visualized on a TapeStation (Agilent). PCR products were electrophoresed on a 2% agarose gel ...