Labshake search
Citations for Agilent :
301 - 350 of 8874 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... glial fibrillary acidic protein (GFAP; polyclonal 1:1000, ZO334, DAKO-Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... and Glial fibrillary acidic protein (GFAP, 1:1000, Dako, G9269). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-rabbit glial fibrillary acidic protein (GFAP) (1:1000, Dako), and anti-mouse S100β (1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescence spectra of proteins containing ZnPPIX were measured from 550-750 nm in a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 430 nm ...
-
bioRxiv - Bioengineering 2021Quote: ... Serotec) mouse monoclonal antibodies, or Aβ40 (1:200, Covance), Iba-1 (1:200, Wako) and GFAP (1:1000, DAKO) rabbit polyclonal antibodies ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP ...
-
bioRxiv - Microbiology 2019Quote: ... Vectors containing mutant riboswitch alleles were generated with the QuickChange Site-Directed Mutagenesis Kit (Agilent) and mated into V ...
-
bioRxiv - Biophysics 2019Quote: Human CAMSAP1 residues 1474-1613 encompassing the CKK domain (HsCKK) were cloned into pET28a vector and expressed in BL21(DE3) cells (Stratagene). Following purification via immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Immunology 2019Quote: ... mutant with Cys20 to Arg and Cys23 to Ser mutations in the RING1 domain was made by site-directed mutagenesis using Quickchange (Stratagene) with primers CCGCTGGTGTCTAGAAAGCTCAGTCTTGGGGAGTAC and GTACTCCCCAAGACTGAGCTTTCTAGACACCAGCGG ...
-
bioRxiv - Cell Biology 2020Quote: ... The cytoplasmic and KASH domains of the mini-nesprin constructs were obtained from a previous publication.22 The mutant domain was made from this construct by site-directed mutagenesis (Quikchange II XL, Agilent). The DN-KASH construct was made by ligation after digestion by ClaI of a PCR product from the mini-nesprin construct ...
-
bioRxiv - Microbiology 2021Quote: A library of IpaC mutants with missense mutations in the coiled-coil domain and flanking regions was generated using error-prone PCR with the GeneMorphII (Agilent) domain mutagenesis kit ...
-
bioRxiv - Cell Biology 2020Quote: ... including glutathione S-transferase (GST)-NEPH1 cytoplasmic domain (CD) and GST-NEPHRIN CD were expressed and purified from Escherichia coli BL21 cells (Stratagene). Purified phosphorylated GST-NEPH1 was expressed and purified from TKB1 cells (Stratagene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... first an AgeI cut-site was knocked into the pcDNA3.1-Myoferlin-HA plasmid immediately prior to the transmembrane domain by site-directed mutagenesis (Agilent: 210518). Second ...
-
bioRxiv - Biophysics 2023Quote: Yeast eIF4G was purified as described previously.46 A pTYB2 vector encoding a C-terminal fusion of eIF4G with an intein and chitin-binding domain was transformed into BL21 CodonPlus RIL cells (Agilent). Protein expression was induced with 0.5 mM IPTG for overnight at 16 °C ...
-
bioRxiv - Immunology 2023Quote: ... in the α3 domain of HLA-A*02:01 described to abrogate binding of CD8 (13) were changed by site-directed mutagenesis (Agilent).
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, California), rabbit anti-S100β (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, CA) and rabbit anti-S100 (1:400 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse α-PCNA (1:500 with antigen retrieval, Dako M087901), rabbit α-L-Plastin (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... a secondary goat-anti-mouse HRP antibody (1:1000, Dako) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotinylated goat-anti-mouse (Dako, Glostrup, Denmark; E0433; 1:200) was used as secondary antibody (1 h ...
-
bioRxiv - Genomics 2020Quote: ... and mouse monoclonal anti-CD31 antibody (1:50, DAKO, M0823) was conducted using goat-anti-rabbit Alexa-488 and goat-anti-mouse Alexa-555 secondary antibodies (Molecular Probes ...
-
bioRxiv - Microbiology 2021Quote: ... and visualized with goat-anti-mouse (PO260, 1:100, Dako) horseradish peroxidase labeled secondary antibody ...
-
bioRxiv - Pathology 2019Quote: ... anti-desmin (1:1000, mouse monoclonal, Dako-Cytomation, Trappes, France) and anti-GAPDH antibody (1:5000 ...
-
bioRxiv - Microbiology 2019Quote: ... A 1:3,000 dilution of goat anti-mouse (Dako, #P0447), anti-rabbit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-PCNA (1:500, Dako, Agilent, Santa Clara, California), rabbit anti-S100β (1:400 ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-PECAM1 monoclonal (clone: JC70A, 1:50, M0823, Dako), mouse anti-CD68 monoclonal (clone ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-PCNA (1:200, M0879, Dako, Agilent, CA, USA), rabbit anti-S100β (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-PCNA (1:200, M0879, Dako, Agilent, CA, USA), rabbit anti-S100β (1:200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit anti-mouse (Agilent, P0260022-2, 1:3000).
-
bioRxiv - Genetics 2023Quote: ... and anti-mouse HRP-conjugated (1:1000) secondary antibody (Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... Both mouse monoclonal anti-Ki67 CloneMIB-1 (Dako, cat# M7240) and rabbit polyclonal antibody MGP (ProteinTech ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse monoclonal anti-CKAE1/AE3 (Dako, M3515, 1:200 dilution) were added to their respective spheroids and incubated for 2 days at 4 degrees ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-human CD68 (Dako #M0814, 1:400 dilution), following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics ...
-
bioRxiv - Neuroscience 2023Quote: ... SMA (mouse anti-SMA, 1:100, Dako, Cat. no. M0851) was assessed after 10 days as described above ...
-
bioRxiv - Plant Biology 2024Quote: ... and secondary antibodies α-mouse-HRP (Agilent, P0260, 1:5000), α-rat-HRP (GE HealthCare ...
-
bioRxiv - Microbiology 2024Quote: ... or rabbit anti-mouse HRP (Dako P0161 1:3000 dilution). Labelled membranes were developed with Immobilon HRP substrate (Millipore Sigma WBKLS0500 ...
-
bioRxiv - Genetics 2023Quote: ... Transcriptional profiling was performed on mouse colon samples using the SurePrint G3 Mouse GE8×60K Microarray kit (design ID:028005, Agilent Technologies). Cyanine-3 (Cy3)-labeled cRNAs were prepared with 100ng of total RNA using a One-Color Low Input Quick Amp Labeling kit (Agilent Technologies) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Primary anti-CD31 antibody in Tris-HCl buffer containing stabilizing protein and 0.015 mol/L sodium azide (Dako Antibody Diluent, Dako, Glostrup, Denmark) were then added to the slides ...
-
bioRxiv - Biochemistry 2019Quote: ... the gene coding for the kinse domain of the Elk receptor was amplified from TKB1 cells (Agilent Technologies, Santa Clara, CA) and cloned with a C-terminal HA-tag between NdeI and EcoRV restriction sites within the second open reading frame of the pCDF-Duet vector ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 1-hour incubation with peroxidase-labeled goat anti-mouse antibodies (1:1000; DAKO) and a 7 min incubation with the True Blue™ (KPL ...
-
bioRxiv - Microbiology 2020Quote: ... or chicken anti-GFAP (Abcam, 1:500, or mouse anti-CD68 (Agilent/Dako, 1:200) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... or chicken anti-GFAP (Abcam, 1:500, or mouse anti-CD68 (Agilent/Dako, 1:200) for 2 hours at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... rabbit anti-glial fibrillary acidic protein (anti-GFAP, 1/2000, Dako). After five rinses in PBST ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-Glial Fibrillary Acidic protein (GFAP) (Z0334, DAKO, 1:500); rabbit anti S100 (Z0311 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (Dako,1:600), mouse monoclonal anti-GFAP (Cell Signaling ...