Labshake search
Citations for Agilent :
301 - 350 of 1840 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Immunology 2024Quote: ... we washed cells twice with 200 μL of assay medium (minimal DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine (Agilent Technologies)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... oligomycin (1 µM) and 2-deoxy-D-glucose (2-DG) (50 mM) (Seahorse Glycolysis Stress Test Kit, Agilent Technologies, 103020-100). Analyses were performed with Wave software 2.3.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked with Protein-Block reagent (Dako, X090930-2) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μl of sample was subjected to TapeStation (Agilent) analysis to ascertain band sizes ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse anti-Ki67 (1:400, M724029-2, Agilent, UK) was used to label proliferative cells and rabbit anti-cleaved-Caspase3 (1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki-67 (M7240) (M724029-2, Agilent, 1:400 dilution), γH2AX (phospho-S139 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse clone CR3/43 (1:20, Agilent, M077501–2). Sections were incubated for 1 hour at room temperature with secondary antibodies (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... and anti-rabbit IgG HRP-linked (P044801-2, Dako). The IRE1 inhibitor STF083010 was purchased from Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2022Quote: ... For detection the EnVision detection system (K500711-2, Dako) was used.
-
bioRxiv - Cancer Biology 2020Quote: ... EnVision+ Dual Link HRP secondary (Agilent, Cat#K406311-2), and the ImmPACT DAB Peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Neuroscience 2021Quote: ... XL-2 Blue ultracompetent bacterial cells (#200150, Agilent Technologies) were subsequently transformed with the ligation mixture and the resulting bacterial cell clones were screened by PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse monoclonal anti-α-SMA (M085129-2, Dako), Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... GFAP (1:500, Z033429-2, Agilent, Santa Clara, CA), and IBA1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-PCNA (1:300; M087901-2 Agilent); guinea pig polyclonal anti-Doublecortin (DCX ...
-
bioRxiv - Microbiology 2023Quote: ... Antibody diluent (Agilent, Santa Clara, CA, USA, # S302283-2) was used as a negative reagent control to replace the primary antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were treated with Protein Block (Dako, #X090930-2) then incubated with primary F4/80 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM l-glutamine (Agilent Technologies, Cat. 103579-100) and 1mM pyruvate (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Neuroscience 2023Quote: ... with DAKO Fluorescent Mounting Medium (Agilent, cat. #S302380-2).
-
bioRxiv - Cancer Biology 2022Quote: ... rabbit anti-mouse IgG HRP (Agilent technologies/P044701-2), goat anti-rat IgG HRP (Abcam/ab57057 ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... and 2 mM glutamine (Agilent Technologies, Cat#:103579-100). Acute 10 μM glutamate injection was applied to four replicate wells/donor/experiment during the mitochondrial stress test (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Lysozyme (Agilent, cat.# A009902-2; 1:300), rabbit anti-Aldolase B/C (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Cell Biology 2024Quote: ... EnVision FLEX TRS High pH (Agilent Cat# GV80411-2), EnVision FLEX TRS Low pH (Agilent Cat# GV80511-2) ...