Labshake search
Citations for Agilent :
301 - 350 of 1271 citations for CEACAM 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Immunology 2021Quote: ... followed by washing and horseradish peroxidase-conjugated rabbit anti-human IgG (1:3,000; Dako). Bound antibodies were detected by adding TMB PLUS2 (Eco-Tek) ...
-
bioRxiv - Genomics 2020Quote: ... LECs were additionally co-stained with mouse anti-human CD31 antibody (clone JC70A, Dako) at a dilution of 1:50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and processed by SureSelectXT Human All Exon V5 (Agilent Technologies, Santa Clara, CA, USA). Captured DNA was sequenced using HiSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: The one-color microarray Human miRNA Microarray Kit (V2) design ID 029297 from Agilent Technologies was used to measure miRNA expression for 425 tumors of the Oslo2 cohort using 100 ng total RNA as input ...
-
bioRxiv - Bioengineering 2022Quote: ... The CGH assays were performed using the SurePrint G3 Human CGH Microarray Kit (Agilent) and the genomic DNA of WTC11 cells as a reference of the diploid cells ...
-
bioRxiv - Genomics 2019Quote: ... The BED files describing the exome capture regions (SureSelect Human All Exon V5, Agilent) were lifted over using the paftools liftover command ...
-
bioRxiv - Immunology 2022Quote: ... IgG binding was detected by incubation with Cy3-rabbit anti-human IgG (Dako Cytomation) labeled according to the manufacturer’s recommended protocols (GE Healthcare) ...
-
bioRxiv - Genomics 2019Quote: An RNA library was first created by pooling the Universal Human Reference RNA (Agilent) with SIRV Isoform Mix E0 (Lexogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-Fgb (rabbit) and anti-human Pecam1 (mouse) were from Dako (Carpinteria, CA, USA). Anti-Alb (sheep ...
-
bioRxiv - Genomics 2019Quote: ... Antibodies used included mouse monoclonal anti-human CD3 (DAKO, clone F7.2.38, dilution 1:50) and mouse monoclonal anti-human CD8 (DAKO ...
-
bioRxiv - Immunology 2022Quote: ... tissue sections were firstly stained with monoclonal anti-human CD45 (DAKO, 2B11+PD7/26), CD20 (DAKO ...
-
bioRxiv - Immunology 2020Quote: ... which were then hybridized to SurePrint G3 Human Gene Expression 60K GeneChip microarrays (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome capturing was performed using SureSelect Human All Exon in-solution capture reagents (Agilent). In case RNA was pooled in for sequencing ...
-
bioRxiv - Immunology 2023Quote: ... or IgA (polyclonal rabbit anti-human IgA/HRP, Dako, P0216, at 1:2000 dilution) was added for 1 hr at room temperature and the enzyme reaction was developed with TMB plus (Kementec ...
-
bioRxiv - Systems Biology 2023Quote: ... 50 Mb targeted exons were captured using SureSelect Human All Exon V5 (Agilent Technologies). Hundred bp paired-end sequence reads of the captured exons were generated using HiSeq 2000 Sequencing System (Illumina ...
-
bioRxiv - Biophysics 2023Quote: Human FKBP12.6 cDNA was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of eight single cysteine mutants (G1C ...
-
bioRxiv - Cell Biology 2022Quote: ... Calibrator cDNA was transcribed from Quantitative PCR Human Reference Total RNA (Agilent Technologies, USA). Relative gene expression was calculated upon normalisation to two reference genes ...
-
bioRxiv - Immunology 2023Quote: ... Antigen-specific IgG was detected using rabbit anti-human IgG HRP (Dako, Glostrup, Denmark). ELISA plates were developed using TMB solution (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library preparation was performed by using SureSelectXT Human All Exon V5 (Agilent, 5190–6209) according to the instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA library hybridization was performed by using Agilent SureSelect Human All Exon V6 (Agilent). Paired-end sequencing (150 bp ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... onto a peptide trap (Zorbax 300 SB-C18, 0.3 i.d. × 5 mm, 5 µm, 300 Å; Agilent Technologies, Santa Clara, CA, USA) for concentration and desalting with a pump running in isocratic mode with 0.1% formic acid in water ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized and blocked in 5% goat serum (DAKO, X0907), 0.3% Triton-X-100 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Immunology 2019Quote: A C18 (Agilent ZORBAX 300SB, 5 μm, 300 Å) pre-column (360 μm o.d ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...