Labshake search
Citations for Agilent :
301 - 350 of 1212 citations for 6 Chloro N methyl 5 nitro 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Bioengineering 2019Quote: ... The electrical state was tested with a resistance meter (34401A 6 ½ Digit Multimeter, Agilent, Santa Clara, CA, USA) between different tapping points (connector – solder pads on interconnecting ceramic – wires anterior to interconnecting ceramic) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... (Mildford, MA, USA) and vacuum manifold system (VacElut 6 Manifold Processing Station, Agilent Technologies, Santa Clara, CA, USA) were used for solid-phase extraction (SPE).
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Biochemistry 2022Quote: ... MNase-digested samples were loaded on 6% PAGE and stained with SybrGOLD and run on a Bioanalyzer (Agilent) using DNA High sensitivity chips ...
-
bioRxiv - Molecular Biology 2023Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions have been obtained by mutating 6 bp of the siRNA-targeting sequence using Quickchange (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Cell Biology 2021Quote: ... A P/O ratio of 2.75 has been validated for calculating the OXPHOS ATP production rate in cells (Romero N et al Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology). Thus ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Immunology 2023Quote: ... was amplified using primers listed in Table S2 and cloned into SrfI and EcoRI-linearized pCMVtag2B vector (N-terminal FLAG epitope-containing plasmid from Agilent Technologies, Cat# 211172) using Gibson Assembly (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Developmental Biology 2023Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...