Labshake search
Citations for Agilent :
301 - 350 of 4857 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit TMEM119 at 1:500 (ab185333, Abcam, mouse PG-M1 at 1:400 (GA61361-2, Dako Omnis, Agilent), mouse P2RY12 at 1:1000 (ab180366 ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Plant Biology 2024Quote: ... Oligosaccharides were reductively aminated with 2-aminobenzoic acid (2-AA) and cleaned using a GlycoClean S cartridge (ProZyme) as previously described (Tryfona & Stephens ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 4×105 treated NK cells were resuspended in Seahorse XF DMEM Medium containing glutamine (1 mM; Agilent, USA) and seeded into an 8-well XF cell culture microplate (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were probed overnight at 4°C with primary antibodies: rabbit anti-human TTR (1:1,000; DAKO, A002); custom-made rabbit anti-mouse TTR antibody (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sections were then incubated overnight at 4 °C with appropriate dilution of anti-Ki67 (1:100, Dako, M7240) in TBS containing Horse Serum (2%) ...
-
bioRxiv - Bioengineering 2024Quote: ... and growth: 4 µL pEVO plasmid library was electroporated into 50 µL XL-1 Blue competent cells (Agilent), recovered in 1 mL SOC media (37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (Seahorse®, Agilent) in a CO2 free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Bluing buffer (Agilent Technologies; Cat # CS703230-2) was then added to the slide until the sections were completely covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... rabbit polyclonal anti-tau (Agilent, A002401-2) at a 1:3000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3E: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM glutamine (Agilent Technologies, 103579-100), and 10 mM glucose (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli SURE 2 Supercompetent cells (Stratagene, USA) for clonal selection and amplification ...
-
bioRxiv - Genomics 2020Quote: ... and FISH Wash Buffer 2 (Agilent, G9402A) at room temperature for 1 min ...
-
bioRxiv - Molecular Biology 2020Quote: The yeast strain YRG-2 (Stratagene, USA) containing the HIS3 and lacZ reporter genes was used to test transcriptional activation activity ...
-
bioRxiv - Physiology 2021Quote: ... with hematoxylin counter stain (Agilent, S330130-2) was used to visualize positive stain ...
-
bioRxiv - Cell Biology 2020Quote: ... Guinea Pig anti-Insulin (Dako IR00261-2) and mouse anti-TAF4 (TAF II p135 ...
-
bioRxiv - Genomics 2021Quote: ... and bluing buffer (Dako, cat.no.: CS70230-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse HRP secondary (DAKO K400111-2), OPAL TSA 520 (Akoya # FP1487001KT) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM glutamine (Agilent, 103579-100), and 10 μM HLM006474 or DMSO (vehicle ...
-
bioRxiv - Neuroscience 2022Quote: ... in antibody diluent (Dako, Cat# S080983-2). Sections were rinsed with PBS (3x 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Physiology 2022Quote: ... in antibody diluent (Agilent, cat#S080983-2) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Neuroscience 2024Quote: Pathology pen (Agilent, cat. no. S2002002230-2)
-
bioRxiv - Physiology 2024Quote: ... and 2 mM glutamine (10359-100, Agilent). Groups of 15 islets were seeded with 5 µl volume into the corresponding detent at the bottom of the wells (29 ...
-
bioRxiv - Microbiology 2024Quote: ... and plate reader (Epoch 2, Agilent BioTek).
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM Seahorse XF glutamine (Agilent) for the mitochondrial oxidation assay or 4 mM L-glutamine for the glycolysis assay ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (Agilent Dako, Poly Rabbit, #GA52461-2), Mac2 (Bio Legend ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (Agilent Dako, Poly Rabbit, #GA52461-2), Mac2 (Bio Legend ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM glutamine (Agilent 103575-100). The long chain fatty acid oxidation stress test (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM 2-DG (Agilent, 103344-100) was added to block glycolysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2) 0.5 µL RNase Block (Agilent #300151) was added per sample (e.g ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies against proliferating cell nuclear antigen (PCNA-1, 1/200, sc-7907, Santa Cruz; PCNA-2, 1/200, M087901, Dako) were applied overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The section was subsequently incubated in primary antibodies (GFAP,1:1000, D1F4Q, Cell Signaling or CD79A, 1:200, M705001-2 DAKO or CD3, 1:100, A0452 DAKO), in BTHP-buffer (1% bovine serum albumin (BSA) ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were counter-stained in methyl green (Dako). Specimens were then dehydrated in series of ethanol and xylene ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Immunology 2024Quote: ... Measurements of ECAR following addition of oligomycin (2 μg/ml; MCE, USA) and 2-deoxyglucose (50 mM; Agilent, USA) allowed for the calculation of basal glycolysis and glycolytic capacity ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...