Labshake search
Citations for Agilent :
301 - 350 of 1972 citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glacial acetic acid was added to dissolve the crystals and the absorbance was measured at 595 nm with a Cytation 3 Image Reader (Agilent). The values of vehicle-treated controls were set to 100%.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... then washed 3 × 10minute and post-fixed with 0.1% PFA for 10minutes and mounted using fluorescent mounting medium (DAKO, USA).
-
bioRxiv - Cell Biology 2023Quote: ... the HA epitope sequence was inserted immediately 3’ to the signal peptide sequence by site directed mutagenesis using the QuickchangeXL site directed Mutagenesis kit (Agilent) to obtain the following intermediate vector ...
-
bioRxiv - Synthetic Biology 2024Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were then washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako anti-rabbit #P0448 or anti-mouse #P0447 ...
-
bioRxiv - Microbiology 2024Quote: ... These pellets were lysed and 3 µl samples were analyzed using Agilent InfinityLab Poroshell 120 HILIC-Z (Agilent 683775-924). The chromatographic separation employed two solvent phases ...
-
bioRxiv - Immunology 2024Quote: ... cDNA and libraries were made using the Lexogen QuantSeq 3’ mRNA-seq FWD library prep kit and quality was assessed by Agilent High Sensitivity DNA kit on a Bioanalyzer (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... blots were washed 3 times during 10 min with PBS-T and incubated with horseradish peroxidase-conjugated secondary antibody (Dako) for 1 h and washed again 3 times ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Microbiology 2024Quote: The separation was performed using a ZORBAX RRHD Eclipse Plus (C18, 3 × 50 mm, 1.8 μm; Agilent Agilent 959757-302) or a Poroshell 120 EC-C18 ...
-
bioRxiv - Biochemistry 2024Quote: ... The effect of PFKFB2/3 inhibitors on glycolysis was determined by glycolysis stress test utilizing Seahorse XFe24 Extracellular Flux Analyzer (Agilent) measuring extracellular acidification rate (ECAR ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Bioengineering 2024Quote: ... sections were washed in PBS three times for 3 minutes each before being incubated with DAKO Rabbit/Mouse HRP Kit-provided HRP (Mouse-K4001, Rabbit-K4003; Dako) for 30 minutes at room temperature ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Plant Biology 2024Quote: ... Amino acid contents were measured using a triple quadrupole LC-MS/MS system (Agilent 6420, CA, USA) with a Discovery HS-F5 column (2.1 × 250 mm ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Bioengineering 2020Quote: ... Pelleted cells by the centrifugation for 3 min at 300 rcf are stained with FITC-conjugated anti-lysozyme antibody (Dako, F0372) and APC-conjugated anti-CD24 antibody (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: Measurements in both settings were performed in 3 min mix and 3 min measure cycles at 37 °C in six replicates per condition on a Seahorse XFe96 Analyzer (Agilent Technologies). OCR and ECAR were depicted as pmol/min and mpH/min ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 µm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15 ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Immunology 2021Quote: ... HES5 and GATA6 genes were made for 3 replicates using the Brilliant III Ultra-Fast SYBR green qPCR master mix (Agilent Technologies) and analyzed on a CFX Opus Real-Time PCR system (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Biophysics 2021Quote: ... then was injected to online SEC-SAXS equipped with a temperature-controlled (15 °C) silica-based SEC column (Agilent BioSEC-3)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...