Labshake search
Citations for Agilent :
3301 - 3350 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Purified libraries were run on Agilent High Sensitivity DNA Kit chip (Agilent Technologies) to verify the expected size distribution ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was assessed by high sensitivity DNA analysis kit (Agilent, 5067-4626) on the 2100 Bioanalyzer instrument ...
-
bioRxiv - Plant Biology 2024Quote: ... and Agilent 2100 Bioanalyser using an RNA nano-chip kit (Agilent Technologies, UK). Library preparation was carried out using Illumina® sequencing TruSeq Stranded Total RNA Library Prep Kit before sequencing of 100 bp paired ends reads using Illumina Genome Analyser GXII platform by the Exeter Sequencing Service (University of Exeter) ...
-
bioRxiv - Immunology 2024Quote: ... The primary antibody was detected using the Envision Labeled Kit (Dako, Glostrup, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... All mutation were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). The DNAs were transformed into BL21-Gold(DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was measured using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together and performed paired-end sequencing on an Illumina Hi-Seq 2000.
-
bioRxiv - Neuroscience 2023Quote: ... Mutagenesis was performed using the QuikChange II Site-directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were constructed using the Sure Select All Exon v6 library kit (Agilent) following the XT library preparation workflow ...
-
bioRxiv - Biochemistry 2024Quote: ... Neomorphic missense mutations were introduced using QuikChange Lightning site-directed mutagenesis kit (Agilent). C ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis was carried out using the QuickChange Lightning kit from Agilent. The two targeted mutation sites were K112M and D207A ...
-
bioRxiv - Plant Biology 2024Quote: ... using the RNA 6000 Nano Kit for standard RNA sensitivity (Agilent, #5067-1511). Three biological replicates were submitted to Novogene (www.novogene.com ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Biophysics 2024Quote: Protein variants were constructed using a QuikChange site-directed mutagenesis kit (Agilent, USA). The primer that introduced desired nucleotide changes was designed using QuikChange online tool (Table S3C ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was generated using AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene). The Mus musculus IGHV1-72*01 allele (IMGT accession number J00530:206-499) ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA isolation and reverse transcription were performed using the Absolutely RNA Miniprep kit (Stratagene) and cDNA synthesis system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibody was pretreated with a biotinylation reagent (Animal Research Kit, DAKO, Denmark) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... avidin-biotin blockade was performed using the avidin-biotin blocking kit (DAKO, Glostrup, Denmark). To eliminate nonspecific protein interactions with the primary antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was amplified and labeled using the low RNA input linear amplification kit (Agilent). Labeled cDNA was hybridized onto Affymetrix Human Gene 2.0-ST array ...
-
bioRxiv - Developmental Biology 2020Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). RNA-seq libraries were constructed using Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... all DNA libraries were checked with Agilent BioAnalyzer High Sensitivity DNA Analysis Kit (Agilent). DNA concentration was measured both by Qubit dsDNA HS assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Molecular mutants were prepared using the QuikChange II XL site-directed mutagenesis kit (Stratagene). The mCherry plasmid was previously described(Pauker ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutagenesis of the Serine345 codon of Kcnk5b was performed using QuikChange Mutagenesis kit (Agilent).
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Quality was determined on a 2100 Bioanalyzer using the RNA 6000 Nano Kit (Agilent). Concentration was determined using a Nanodrop 8000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... primer P3 (Table S2) was used in the QuikChange Multisite-directed mutagenesis kit (Agilent), and the resulting plasmid was transformed into XL10 Gold ultracompetent Escherichia coli cells ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA-Seq libraries were prepared using the SureSelect Strand-Specific RNA-Seq Kit (Agilent), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cluster optimization were performed using the QPCR NGS Library Quantization Kit (Agilent Technologies). RNA-seq libraries were pooled (4-plex ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was harvested and quantified with the Bioanalyzer DNA High-Sensitivity kit (Agilent Technologies). Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality and quantity was assessed using Agilent High Sensitivity DNA kit (Agilent Technologies) and Qubit dsDNA HS assay kit (Thermo Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... RNA quality was assessed using a Bioanalyzer 2100 with RNA 6000 Nano kit (Agilent). 500ng of total RNA or mRNA for each sample were then digested to single nucleosides as previously described (Courtney et al ...