Labshake search
Citations for Agilent :
3251 - 3300 of 4652 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Immunology 2023Quote: ... Immunodetection was performed by incubation with horseradish peroxidise-conjugated anti-rabbit (1:5000) (DAKO) and developed by enhanced chemiluminescence (Millipore).
-
bioRxiv - Physiology 2023Quote: ... and the mitochondria are resuspended in 1 mL of Seahorse medium (Agilent #103335–100) with supplemented 5 mM pyruvate (Sigma #P2256-100G) ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mL of the supernatant was analyzed with a spectrophotometer (CARY-60, Agilent) at 565 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sections were incubated with primary antibody anti-ki67 (MIB-1, catalog no. IR626, DAKO) or anti-cleaved caspase-3 (catalog no ...
-
bioRxiv - Cancer Biology 2024Quote: ... and slides were incubated with the rabbit anti-goat Biotinylated (E0466, 1:200; DAKO) and the visualization system Envision anti Rabbit (K4033 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or anti-rabbit immunoglobulin/HRP secondary antibody (Agilent, Cat# P0448, RRID: AB_2617138; 1:5000) for 60 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... The second sequence involved incubation with anti-CD20 clone L26 (1:250, M0755, Agilent) using the same protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Biophysics 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... run 1 μl of sample on an Agilent Bioanalyzer High Sensitivity chip (Agilent, Cat#: 50674626) for cDNA QC & Quantification.
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of the odor sample was injected in a DB5 column (Agilent Technologies; www.agilent.com), fitted in an Agilent 6890 gas chromatograph ...
-
bioRxiv - Neuroscience 2021Quote: ... UK) overnight and anti-mouse IgG alkaline phosphatase-linked secondary antibody (1:5,000; Dako, USA). Membranes were incubated with CDP-Star chemiluminescent substrate (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... Target proteins were identified by the horseradish peroxidase-labeled streptavidin-biotin method (1:300, DAKO). In the immunofluorescence experiments ...
-
bioRxiv - Genomics 2020Quote: ... DNA was eluted into 53 µl with 1 µl used for D1000 TapeStation analysis (Agilent) and 2 µl used for Qubit quantification (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was solubilized to an OD260 of 1 and analysed in the Bioanalyzer (Agilent) for quality and quantity estimation for RNA-seq ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies coupled with horseradish peroxidase (HRP): goat anti-mouse (Dako P0447, WB: 1/1000), goat anti-rabbit (Dako P0448 ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA integrity was verified on 1% agarose gel and by RNA Screen Tape assay (Agilent). cDNA was produced with High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Plant Biology 2020Quote: ... Purified VIPP1 at a concentration of 1 μM was injected onto a C18 column (Agilent Zorbax Eclipse Plus C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 µl aliquot of the sample was injected into Agilent GC-MSD (Agilent 7890B-5977B) system equipped with the Rxi-5Sil MS column (30 m × 0.25 mm × 0.25 μm film thickness ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used in this study: rabbit anti-GFAP (DAKO, 1:600), mouse anti-GFAP (Cell Signaling ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µL of sample was injected in splitless mode with an autosampler (Model G4513A, Agilent). Column flow was kept constant at 1mL min-1 with helium as a carrier gas ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were then antibody stained with guinea-pig anti insulin (1:500, Dako, Carpinteria, CA), Alexa Fluor 647 anti guinea-pig (1:1000 Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE, Agilent Technologie) at RT for 30min ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed and then secondary antibody (Envision+System HRP labelled polymer Anti-Rabbit, Dako 1:100).
-
bioRxiv - Cancer Biology 2021Quote: ... the following antibodies were used: anti-panCK (mouse, 1:1,000; DAKO, M3515, Clone AE1/AE3), anti-PHH3 (rabbit ...
-
bioRxiv - Physiology 2022Quote: ... fetal capillary endothelium and placental trophoblasts were distinguished using anti-vimentin (Dako Vim3B4: 1:100) and anti-pan cytokeratin (Sigma C2562 ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1: 50 with polymer-based EnVision FLEX detection system (Dako K8021, les Ulis - France) utilizing onboard Dako Omnisautomate OMNIS (Dako ...
-
bioRxiv - Biochemistry 2019Quote: ... Peptides were acidified with 1% TFA and purified on Omix C18 tips (Agilent, catnr. A57003100), dried and re-dissolved in 20 µl loading solvent (0.1% TFA in water/acetonitrile (98:2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and HRP-conjugated anti mouse IgG raised in goat (Dako-Agilent #P0447, dilution 1:500).
-
bioRxiv - Cell Biology 2020Quote: ... and HRP-conjugated anti mouse IgG raised in goat (Dako-Agilent #P0447, dilution 1:500).
-
bioRxiv - Microbiology 2021Quote: ... and type 1 IFN response (Mx1) was performed with MPO (Dako Cat. No. A0398; polyclonal) at 1:1000 detection using Rabbit Polink-1 HRP ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...