Labshake search
Citations for Agilent :
3201 - 3250 of 8606 citations for Estriol ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... a final round of random mutagenesis was performed using the GeneMorph II kit (Agilent). Yeast plasmids are available through Addgene (https://www.addgene.org/158585/ ...
-
bioRxiv - Genomics 2021Quote: ... Library quality and size were assessed using a Bioanalyzer High Sensitivity DNA kit (Agilent). Libraries were run on HiSeq 4000 and NovaSeq6000 in 150 bp × 2 paired-end mode (Illumina ® ...
-
bioRxiv - Genetics 2020Quote: ... Point mutation was generated by a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). All plasmid sequences were verified by sequencing before use.
-
bioRxiv - Molecular Biology 2021Quote: ... The H188A mutation was introduced by QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA library was constructed using the SureSelect Low Input library prep kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified using a BioAnalyser high sensitivity DNA kit (Agilent, Cat#5067-4626) and a Qubit high-sensitivity dsDNA kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... Ezrin was visualized using 3,3’-diaminobenzidine from the DAB+ kit (Agilent, Santa Clara, USA). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA quality was assessed using an RNA 6000 Pico kit (Agilent, 5067-1513) on a Bioanalyzer (Agilent G2939A).
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was quality-accessed with an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit) with RNA integrity number above 9 for library construction ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies) in a BioAnalyzer instrument (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 at a read length of 38 bp.
-
bioRxiv - Molecular Biology 2022Quote: ... and library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). DNA libraries were sequenced with an Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the sections were incubated in HRP rabbit/mouse secondary antibody (DAKO Real EnVision kit) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was performed to create the FLOT2 G2A and FLOT2 Y163F mutants ...
-
bioRxiv - Bioengineering 2022Quote: ... and site-directed mutagenesis was performed using the QuikChange Site-Directed Mutagenesis Kit (Agilent). The introduction of mutations was confirmed through sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations of LcTwinkle were generated using methods described in the QuikChange mutagenesis kit (Agilent). Sequences of the LcTwinkle constructs were confirmed by sequencing the entire reading frames of each construct ...
-
bioRxiv - Cancer Biology 2022Quote: ... and antigens were visualized with a DAKO Envision Kit (HRP/DAB System; Dako Cytomation).
-
bioRxiv - Cell Biology 2022Quote: ... HA-tagged DCX mutant T203R were created using QuikChange Site-Directed Mutagenesis kit (Stratagene). HA-tagged DCX mutant A71S was synthesized commercially (Genewiz ...
-
bioRxiv - Cell Biology 2022Quote: ... Amplified cDNA was cloned into pSC plasmid (StrataClone Blunt PCR Cloning Kit, STRATAGENE, 240207). Then ...
-
bioRxiv - Genetics 2022Quote: ... The SphI site was mutated to XhoI using a site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... and evaluated using an Agilent 2100 Bioanalyzer (5067-1513, Agilent RNA 6000 Pico Kit). After DNase I (M0303S ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... kit and also checked in the Agilent 2100 Bioanalyzer High Sensitivity DNA (Agilent Technologies). The libraries were run in the in-house Illumina NextSeq 500 using the 300-cycle mid-or high-output kit.
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from mouse lungs using the Absolutely Total RNA Purification Kit (Agilent). RNA extraction from cell culture experiments were performed using the Qiagen RNeasy kit (Qiagen) ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... Site-directed mutations were created using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The FANCD2 ΔTower construct was generated using a QuikChange Site-Directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and fragment size was controlled using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The mutated SV40 enhancer sequences were created with QuickChange site-directed mutagenesis kit (Stratagene) or using InFusion site-directed mutagenesis ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were analyzed using Agilent RNA 6000 Nano Kit and the Bioanalyzer system (Agilent). Thereby ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Neuroscience 2022Quote: ... The concentration of extracted RNA was determined using a NanoRNA kit (Agilent #5067-1511) and Bioanalyzer (Agilent 2100 ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality was evaluated using the Agilent DNA 1000 kit (Agilent, Cat# 5067-1504) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Cell Biology 2024Quote: ... The staining was performed with the Dako LSAB2 System-HRP kit (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library size distributions were confirmed using the High Sensitivity DNA Kit (Agilent #5067-4626) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Systems Biology 2024Quote: ... Both mutations were made using the QuikChange Lightening Site directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions and the sequences were confirmed by DNA sequencing at the Department of Biochemistry (University of Cambridge ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality was checked using RNA 6000 Pico Kit using Agilent 2100 Bioanalyzer (Agilent). Paired-end ...
-
bioRxiv - Neuroscience 2024Quote: ... Southern blot probes were radiolabeled using the Prime-it Random Primer Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis to generate shfP mutants was achieved using the QuikChange kit (Agilent). All plasmids were integrated into the B ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked for quality with Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany). Only RNA samples with RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: ... Library QC was performed using the BioAnalyzer High Sensitivity DNA Kit (Agilent, #5067-4626) and run on the 2100 BioAnalyzer Instrument ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA quality was assessed using the RNA 6000 Nano kit total RNA assay (Agilent) run on the 2100 Bioanalyzer instrument (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... site directed mutagenesis was used (QuikChange II XL Site Directed Mutagenesis Kit, Agilent, 200521) as directed ...
-
bioRxiv - Immunology 2024Quote: Extracellular flux assay was performed using Seahorse XF Cell Mito Stress Test Kit (Agilent). 24 hours prior to the assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library concentrations were quantified using the Agilent High Sensitivity DNA kit (Agilent Technologies, USA). An equimolar pool consisting of 24 samples was prepared and sequenced on an NextSeq550 (single-read ...
-
bioRxiv - Immunology 2024Quote: ... C188Y and Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 and K183S/K184S/*192C*24 plasmids were produced by ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... Site-directed mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.