Labshake search
Citations for Agilent :
3151 - 3200 of 7968 citations for Mouse Antigen peptide transporter 2 TAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Immunology 2023Quote: ... Cellular sphingolipids were analyzed after extraction with methanol:chloroform (2:1) using a 1290 Infinity II HPLC coupled with a 6495C triple-quadrupole mass spectrometer (Agilent Technologies) as previously described (Naser et al. ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Jackson ImmunoResearch Laboratories and was used for Western blotting. Affinity-purified rabbit polyclonal anti-human lambda-light chain (cat. A019302-2) was purchased from Dako and was used for Western blotting ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... HCT-8 cells or HCT-8 AhR KO cells were plated at 2 x 104 cells per well in a 96-well Seahorse XF96 cell culture microplate (Agilent) and grown for ∼24h ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Genomics 2024Quote: ... The high-molecular weight DNA sample was then sheared to a mean size of 20 kb with a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and the subsequent size distribution was assessed with an Agilent Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Plant Biology 2024Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Biochemistry 2024Quote: ... The plates were then shaken for 2 minutes and luminescence was measured using the BioTek Cytation 5 cell imaging multimode reader (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... The final co-cultures were then incubated at 37°C in an automated spectrophotometer (Biotek Synergy 2, Agilent Technologies, USA) for 48 hours ...
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... tissues were incubated with primary antibodies overnight (Iba1 (019-19741, FUJIFILM Wako Pure Chemical Corporation) or S100b (GA50461-2, Agilent)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using the Qubit Fluorometer (dsDNA High Sensitivity Kit) and average fragment length distribution was determined by the Bioanalyzer (Agilent, High Sensitivity DNA kit, 5067-4626). Prepared libraries were multiplexed in pools of equimolar concentrations and sequenced on the NextSeq 500 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using the Qubit Fluorometer (dsDNA High Sensitivity Kit) and average fragment length distribution was determined by the Bioanalyzer (Agilent, High Sensitivity DNA kit, 5067-4626). Prepared libraries were multiplexed in pools of equimolar concentrations and sequenced on the NextSeq 500 (Illumina ...
-
bioRxiv - Plant Biology 2019Quote: ... were introduced by the Quick-Change PCR mutagenesis kit protocol (Stratagene), using the primer combinations listed in Supplemental Table 2 and PhusionTM High-Fidelity DNA Polymerase (Finnzymes) ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were profiled by Bioanalyzer High Sensitivity DNA kit (Agilent Technologies) and quantified using Kapa Library Quantification Kit (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... then cDNA was synthesized using AffinityScript cDNA Synhtesis Kit (Agilent, 200436). Relative expression of genes was quantified using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: ... we used the QuikChange Lightening Multi Site-Directed Mutagenesis kit (Agilent) as per the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... We performed site-directed mutagenesis using the QuikChange II kit (Agilent), as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... we used the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and Qubit Fluorometer (RNA High Sensitivity kit: Cat# Q32852; Agilent Technologies), while the integrity was assessed on the Agilent 4200 TapeStation system using RNA HS ScreenTape (Cat# 5067-5579 ...
-
Systemic impact of the expression of the mitochondrial alternative oxidase on Drosophila developmentbioRxiv - Biochemistry 2022Quote: ... and the RNA 6000 Nano LabChip kit/Bioanalyzer 2100 (Agilent Technologies). One µg samples of RNA with high integrity number (RINe > 8.9 ...