Labshake search
Citations for Agilent :
3001 - 3050 of 9267 citations for Human Fragile X Mental Retardation 1 Neighbor Protein FMR1NB ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM pyruvate (Agilent Technologies, UK), 2 mM L-glutamine ...
-
bioRxiv - Immunology 2024Quote: ... FCCP (1 µM; 103672-100; Agilent) and Rotenone/Antimycin A (0.5 µM ...
-
bioRxiv - Neuroscience 2024Quote: ... Total Tau (DAKO Potts, 1:200), DA9 (gift from Peter Davies ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-GFAP (DAKO, z0034, 1:1000), anti-fibronectin (Merck ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10 and 1:50 dilutions of the library on a Bioanalyzer High sensitivity DNA Chip (Agilent) and running it on Bioanalyzer 2100AB (Agilent) ...
-
bioRxiv - Immunology 2022Quote: ... Total IgG Abs were affinity-captured from plasma or sera using a Protein G AssayMAP Cartridge Rack on the Bravo (Agilent Technologies, Santa Clara, CA) or Protein G Sepharose 4 Fast Flow beads (GE Healthcare ...
-
bioRxiv - Biophysics 2019Quote: The MBP-5-HT3A-ICD-pMALX soluble fusion proteins were overexpressed in Escherichia coli (E. coli) BL21-CodonPlus (DE3)-RIPL cells (Agilent Technologies; Santa Clara, CA). The cells were harvested by centrifugation (5,000 g for 15 min at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... elegans PGL-3 NtDD wild type and mutant recombinant protein were determined by conducting SEC-MALS experiments using Agilent Technologies 1260 LC HPLS system (Agilent Technologies, Santa Clara, CA) equipped with Dawn® Heleos™II 18-angle MALS light scattering detector ...
-
bioRxiv - Cancer Biology 2022Quote: Pan-HLA Class I-specific antibody (clone W6/32) was coupled to Protein-A resin packed into AssayMAP Bravo compatible large capacity cartridges (PA-W 25 μL) (Agilent, Part number G5496-60018). The coupled antibodies were then crosslinked with 20 mM Dimethyl pimelimidate dihydrochloride (DMP ...
-
bioRxiv - Biophysics 2024Quote: Accurate masses of unlabeled and labeled proteins were determined via LC-MS with an Agilent PL1912- 1300 reverse phase HPLC column (Agilent, Santa Clara, CA, USA) connected to an AB Sciex 5600 QTOF mass spectrometer (AB Sciex ...
-
bioRxiv - Biochemistry 2022Quote: ... the UV-visual absorbance spectra of conjugated proteins were recorded in the range 200–700 nm using Agilent Cary 100 absorbance spectrophotometer (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Plant Biology 2020Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as a control of positive interaction (C+) ...
-
bioRxiv - Biophysics 2021Quote: ... a tile system was created using the Quikchange Lightning Multi kit (Agilent), as reported earlier (Kozek et al. ...
-
bioRxiv - Biophysics 2020Quote: ... using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... staining was revealed using the IDetect Super strain HRP polymer kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and sizing was determined by Fragment Analyzer HS Small Fragment Kit (Agilent). A smear analysis was conducted in the range of 150 to 1000 bp ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR mutagenesis was performed using QuickChange II site directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Site-directed mutagenesis was performed using Quikchange Lightning mutagenesis kit (Agilent Technologies) and pEGFP-c1 hsOCRL1 (wild-type ...
-
bioRxiv - Cell Biology 2020Quote: ... and Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the Low-Input QuickAmp kit (Agilent, Santa Clara, CA, USA). The resulting cRNA was purified using the Absolute RNA Nanoprep kit (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). Libraries were sequenced on a HiSeq 4000 (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared using the SureSelect XT Library Prep Kit (Agilent) following the manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). The libraries were sequenced on an Illumina MiSeq ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and analysis using the Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). High quality samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Developmental Biology 2020Quote: ... Chromogenic detection was implemented with EnVision Detection System-HRP (DAB) kit (Dako).
-
bioRxiv - Systems Biology 2022Quote: ... Sample quality and concentration were assessed by bioanalyzer (High Sensitivity kit, Agilent) and Qubit (Thermofisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCDH15 108N mutations were generated using the QuikChange Lightning mutagenesis kit (Agilent) and mutant protein fragments were expressed and purified identically to the wild-type constructs ...
-
bioRxiv - Genomics 2020Quote: ... with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI) ...
-
bioRxiv - Genomics 2020Quote: ... and quality controlled using a Bioanalyser High Sensitivity DNA Analysis kit (Agilent). Twelve liver ATAC-seq libraries arising from 3 biological replicates x 4 time points (T1-T4 ...
-
bioRxiv - Biochemistry 2020Quote: ... were constructed via the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... samples were incubated with secondary HRP-conjugated antibody (from DAKO envision kit) for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mutagenesis was carried out using QuikChange Lightning Multi kit (Agilent cat#210515); sequence changes were confirmed by DNA sequencing (Retrogen Inc.) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mutagenesis was performed using the QuikChange Lightning site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: Samples were analyzed by bioanalyzer using DNA-1000 kit (Agilent #5067-1504). Concentration of each library was determined by integrating under the peak of approximately 225-275bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the RNA 6000 Nano Kit (Agilent Technologies; cat. no. 5067-1511).
-
bioRxiv - Genomics 2019Quote: ... RNA profiles were then checked by Bioanalyzer (Agilent RNA 6000 Nano kit) and 1ug of RNA from each condition was used for mRNA-seq ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2019Quote: ... using the Seahorse XF Cell Mito Stress test kit (Agilent, 103015-100). 150.000 peritoneal macrophages and 25.000 primary hepatocytes were plated per well respectively ...
-
bioRxiv - Physiology 2019Quote: ... Quality of RNA was assessed using a RNA nano Bioanalyzer kit (Agilent) using a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Bound primary antibody was detected with an immunoperoxidase kit (EnVision Plus; Dako). Negative controls without primary antibody were used for all samples to confirm specificity ...
-
bioRxiv - Cell Biology 2019Quote: ... while site directed mutagenesis was done using the QuickChange II kit (Agilent). Complex reconfigurations of vector backbones and all point mutations were subsequently verified using standard Sanger sequencing (Macrogen ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis was performed with the QuikChange site-directed mutagenesis kit II (Stratagene) and successful mutagenesis was confirmed by sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2021Quote: ... For secondary antibody incubation and signal detection LSAB and AEC Kits (DakoCytomation) were used following the manufacturers protocol ...
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...