Labshake search
Citations for Agilent :
251 - 300 of 6802 citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Captured samples for shotgun sequencing were indexed using universal iP5 and unique iP7 indices (Meyer & Kircher, 2010) and purified with AMPure XP beads (Agilent). The libraries were then pooled in equimolar ratios ...
-
bioRxiv - Genomics 2022Quote: ... into 1 mL 96 well plates and sealed with a silicone plate mat (Agilent, Santa Clara, CA). Aliquots of 12 samples from each row were combined into pools ...
-
bioRxiv - Bioengineering 2022Quote: ... bacterial cell densities were measured using a plate reader (BioTek Synergy H1 Plate reader, Agilent Technology, USA) at an optical density of 600 nm ...
-
bioRxiv - Physiology 2023Quote: ... The plate was immediately loaded into a Biotek Synergy 4 96-well plate reader (Agilent Technologies, USA), and NADPH fluorescence (340/460 excitation/emission ...
-
bioRxiv - Molecular Biology 2021Quote: ... deparaffinized sections were subjected to antigen retrieval and processed with the EnVision+ HRP kit (K401111–2, DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... total RNA from PBMC’s from 2 ml of blood was extracted using AllPrep DNA/RNA Micro Kit from Agilent Technologies (Cat ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 Mpro mutants were generated with QuikChange® II Site-Directed Mutagenesis Kit from Agilent (Catalog #200524), using plasmid pE-SUMO-Mpro as the template ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Physiology 2023Quote: ... The absorbance of the plate was read at 570 nm using a plate reader (Synergy H1, Agilent BioTek). Fat body TAG content was determined as described above ...
-
bioRxiv - Biophysics 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... The chromogen used was that included in the DAKO REAL Detection System (K 5005, Dako). Samples were counterstained with hematoxylin (H-3401 ...
-
bioRxiv - Cancer Biology 2021Quote: ... all tissue sections were stained using a DakoReal EnVision Detection System (Dako, Carpentaria, CA, USA) in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative detections of 15N2 and 15NO were performed by GC/MS (model 7890A/5975C, Agilent) equipped with a CP-Molsieve 5A Plot (25 m×0.32 mm×30 μm ...
-
bioRxiv - Cancer Biology 2020Quote: ... chromogen detection (with HRP polymer, anti-rabbit or anti-mouse, with Envision System from Dako) and hematoxylin counterstaining were performed per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1: 50 with polymer-based EnVision FLEX detection system (Dako K8021, les Ulis - France) utilizing onboard Dako Omnisautomate OMNIS (Dako ...
-
bioRxiv - Plant Biology 2020Quote: ... Separation and detection was next performed using an Agilent 1200 series HPLC system (Agilent Technologies) as previously reported (Fraser et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... chromogen detection (with HRP polymer, anti-rabbit or anti-mouse, with Envision System from Dako) and hematoxylin counterstaining were performed per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Transcript quantification was carried out using Stratagene MX3000P real-time PCR detection system (Agilent Technologies) with FIREPol® EvaGreen® Mix (Solis BioDyne) ...
-
bioRxiv - Cancer Biology 2022Quote: ... secondary antibody followed by 10 min incubation with the DAB substrate/chromogen detection system (DAKO). The sections were counterstained for 2 min with hematoxylin (0.1%) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Synthesis of cDNA from isolated RNA as well as a Universal Human Reference RNA that was used as negative control or for normalization (HREF, Stratagene/Agilent # 740000) was performed using an oligo-dT primed SuperScript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The qPCR reactions were performed with SsoAdvanced™ Universal SYBR® Green Supermix in a Stratagene Mx3005P qPCR System (Agilent Technologies) with an optimized dilution of cDNA (accessed via dilution series for each oligo pair) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Genomics 2023Quote: Each purified GST-tagged DBD stock was validated for DNA-binding specificity using 4×44k universal protein-binding microarrays (PBMs) (Agilent Technologies), as described previously42 ...
-
bioRxiv - Immunology 2019Quote: ... Seahorse 96 well assay plates (Seahorse Bioscience) were coated with Cell-Tak suspension (Corning) ...
-
bioRxiv - Physiology 2021Quote: Cells seeded in Seahorse plates (Agilent Technologies) were washed with assay medium (Seahorse XF DMEM supplemented with 6mM glucose ...
-
bioRxiv - Immunology 2020Quote: ... Plates were developed using TMB (Dako, S1599) and neutralized with 2N H2SO4 ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded in XFp plates (Agilent) at either 1.5×103 cells/well the day before experiment when growing in CPT medium ...
-
bioRxiv - Immunology 2022Quote: ... and a well-plate autosampler (#G1367A, Agilent). Peptides were first loaded onto a 4 cm trapping column (made in-house ...
-
bioRxiv - Pathology 2023Quote: ... A BioTek Synergy H1 plate reader (Agilent) with Gen5 software (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... using a Synergy H1 plate reader (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... Plates were imaged on a Cytation7 (Agilent), and foci were counted using Gen5 software ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Cell Biology 2020Quote: A library encoding ARHGAP36 isoform 2 mutants was created via error-prone PCR (epPCR) using the GeneMorph II Random Mutagenesis Kit (Agilent). To determine the optimal epPCR conditions for library generation ...
-
bioRxiv - Microbiology 2021Quote: ... Mutant SARS-CoV-2 expression plasmids were generated by site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent). Unless otherwise stated all SARS-CoV-2 spike expression plasmids were based on the Wuhan-hu-1 reference sequence 41 ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Plant Biology 2021Quote: ... The SEGS-2 ATG mutant (pNSB2110) was created in S2-1.5b (pNSB1869) using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and the primers ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation and the combination of mutations found in SARS-CoV-2 variants were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana vesicular stomatitis virus (VSV ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Microbiology 2020Quote: ... DNA removal was confirmed by PCR using primers OL398 and OL399 (Table 2) and RNA quality was assessed using an Agilent 2100 Bioanalyzer system with corresponding RNA 6000 Nano kit (Agilent) to confirm RNA integrity (RIN) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... Mutation of glycine at position 2 to alanine was accomplished using the Quick-Change Mutagenesis kit (Agilent, Santa Clara, CA) to generate ptubTgFBXO1HAG2A.
-
bioRxiv - Microbiology 2021Quote: ... D950N) were prepared from wild-type SARS-CoV-2 spike using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent). Additional RBD mutations were introduced into the Delta spike also using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent) ...
-
bioRxiv - Biochemistry 2021Quote: About 2 µg of obtained total RNA was immediately used for cDNA formation using AccuScript High Fidelity cDNA Synthesis Kit (Agilent). RT-qPCR was performed in a 96-well plate on a CFX96 qPCR system (BioRad) ...
-
bioRxiv - Immunology 2022Quote: ... SARS-COV-2-Strunc variants were generated in house by site-directed mutagenesis (QuikChange Multi Site-Directed Mutagenesis Kit, Agilent) starting from synthetic DNA (Genscript) ...
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...