Labshake search
Citations for Agilent :
251 - 300 of 4087 citations for 7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... and fluorenylmethoxycarbonyl (FMOC) was based on the application note “Automated amino acids analysis using an Agilent Poroshell HPH-C18 Column” by Agilent. The samples were injected onto a 100 mm x 3 mm InfinityLab Poroshell HPH-C18 column (2.7 μm ...
-
bioRxiv - Immunology 2019Quote: Purified recombinant His-tagged C-terminal MSP1 protein (amino acids 4960 to 5301) (Ndungu et al., 2009) was biotinylated and tetramerized with streptavidin-PE (Prozyme), as previously described (Krishnamurty et al. ...
-
bioRxiv - Genetics 2019Quote: ... into the complete open reading frame of the canonical 307 amino acid human NMNAT2 isoform cloned into expression vector pCMV-Tag2 (Stratagene). The expressed NMNAT2 proteins have a Flag tag and short linker sequence (17 amino acids ...
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Microbiology 2020Quote: ... The 13C-labeling patterns of proteinogenic amino acids were determined on a 6890N Network GC system with a 5975 inert XL mass selective detector (Agilent Technologies Inc. ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2020Quote: The mCherry-TRAK1 deletion mutant mCherry-TRAK1Δ was obtained by inserting a stop codon after amino acid 635 of the mCherry-TRAK1 encoding nucleotide sequence by means of a PCR-based mutagenesis (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene). The GFP-Rem-T7 partial deletion mutants (GFP-RemΔ103-155-T7 ...
-
bioRxiv - Physiology 2022Quote: ... This construct has an artifactual amino acid change in its coding sequence (I143V) and site-directed mutagenesis (Quikchange II XL, Agilent) was performed to convert it back to WT with following two primers (all primers were ordered from Integrated DNA Technologies):
-
bioRxiv - Microbiology 2023Quote: Binding of VHHs to spike proteins on the surface of mammalian cells was determined by flow cytometry using pcG1-expression plasmids containing the coding sequence of the SARS-CoV-2 spike protein from which the C-terminal 18 amino acids were deleted and in which the D614G substitution was introduced by QuickChange site-directed mutagenesis (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The substitution of amino acids via SDM was carried out using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Point amino acid substitutions in genes encoding GluN subunits were performed using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequencing.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Amino acid substitutions or deletions were introduced into the pSARS-CoV-2-SΔ19 expression vector by site-directed mutagenesis (Stratagene, La Jolla, CA) by following the manufacturer’s instructions and using mutagenic oligonucleotides SaCoV2-K417T-F ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rabbit anti-goat IgG (500 ng ml−1, 1% BSA in PBST; Agilent, P044901-2), for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with HRP-coupled secondary antibody (Agilent Dako #P044801-2, 1/10000 dilution) for 2h at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/600 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), and CD68 (ready-to-use ...
-
bioRxiv - Immunology 2022Quote: ... at a 1/250 dilution (in Envision Flex diluent (K800621-2, Agilent Technologies), CD31 (ready-to-use ...
-
bioRxiv - Plant Biology 2023Quote: ... The ICP multi-element standard solution Intelliquant No.1 and 2 from Agilent were used for calibration using following concentrations ...
-
bioRxiv - Immunology 2023Quote: ... the slides were washed with Gene Expression Wash Buffers 1 and 2 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: gp-insulin (Agilent/DAKO IR002, 1:2), mo-glucagon (Sigma-Aldrich #G2654 ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Immunology 2022Quote: FFPE tissue sections were deparaffinized and antigen retrieval was undertaken in 0.1 M citric acid buffer solution (Dako, target retrieval solution, S169984-2) using an electric pressure cooker (Russell Hobbs RHNHP401) ...
-
bioRxiv - Molecular Biology 2019Quote: ... plasmid was used and the mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... amino acid substitutions were introduced using a QuikChange II XL site directed mutagenesis kit (200521) purchased from Agilent (Santa Clara, CA). After transformation into BL21-Gold (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids harboring GlnR amino acid substitutions (pET28a-glnR derivatives) were constructed using site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Agilent, Inc.).DNA fragments consisting of different canonical GlnR-dependent promoters (narG whose downstream genes encoding M ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...