Labshake search
Citations for Agilent :
251 - 300 of 1612 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA from each extraction was quantified using a NanoDropTM One spectrophotometer and integrity analysed using a Bioanalyzer (Agilent) with the RNA 6000 Nano kit ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Molecular Biology 2023Quote: ... One µL of the library was analyzed on an Agilent 2100 Bioanalyzer using a High Sensitivity DNA chip (Agilent) to assess product profiles and concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... Epoch 2 (BioTek, now: Agilent Technologies) or Infinite 200 Pro (TECAN trading AG ...