Labshake search
Citations for Agilent :
251 - 300 of 1624 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell number and viability were assessed every 2 days for 2 weeks by flow cytometry on an ACEA NovoCyte 2060 (Agilent, USA). ACEA NovoExpress (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked with Protein-Block reagent (Dako, X090930-2) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μl of sample was subjected to TapeStation (Agilent) analysis to ascertain band sizes ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse anti-Ki67 (1:400, M724029-2, Agilent, UK) was used to label proliferative cells and rabbit anti-cleaved-Caspase3 (1:40 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and transformed into electrocompetent SURE 2 cells (Agilent, #200152). Transformants were inoculated into 500 ml of 2xYT media containing 100 μg/ml carbenicillin and incubated overnight at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... and rabbit anti-human myeloperoxidase (A039829-2, Dako, USA) at 1:300 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki-67 (M7240) (M724029-2, Agilent, 1:400 dilution), γH2AX (phospho-S139 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse clone CR3/43 (1:20, Agilent, M077501–2). Sections were incubated for 1 hour at room temperature with secondary antibodies (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... and anti-rabbit IgG HRP-linked (P044801-2, Dako). The IRE1 inhibitor STF083010 was purchased from Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2022Quote: ... For detection the EnVision detection system (K500711-2, Dako) was used.
-
bioRxiv - Molecular Biology 2019Quote: ... and UV-crosslinked (2×2400 μJoules, Stratagene UV crosslinker) in two P15 Petri dishes on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... EnVision+ Dual Link HRP secondary (Agilent, Cat#K406311-2), and the ImmPACT DAB Peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Neuroscience 2021Quote: ... XL-2 Blue ultracompetent bacterial cells (#200150, Agilent Technologies) were subsequently transformed with the ligation mixture and the resulting bacterial cell clones were screened by PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse monoclonal anti-α-SMA (M085129-2, Dako), Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were treated by Bluing Buffer (Agilent, CS70230-2) at RT for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2 mM Seahorse XF Glutamine Solution (Agilent) at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a 30-minute protein block (Dako, X090930-2) before incubating with H3K36me3 primary antibody (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... rabbit anti-mouse IgG HRP (Agilent technologies/P044701-2), goat anti-rat IgG HRP (Abcam/ab57057 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-PCNA (1:300; M087901-2 Agilent); guinea pig polyclonal anti-Doublecortin (DCX ...
-
bioRxiv - Microbiology 2023Quote: ... Antibody diluent (Agilent, Santa Clara, CA, USA, # S302283-2) was used as a negative reagent control to replace the primary antibodies ...