Labshake search
Citations for Agilent :
251 - 300 of 1840 citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution High pH (Agilent Cat#GV80411-2), 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution Low pH (Agilent Cat#GV80511-2), Retrieval Solution High pH (Agilent Cat#GV80411-2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako REAL Peroxidase-blocking reagent (Agilent S202386-2), bluing reagent (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Vimentin primary antibody (Agilent, Cat#M072529-2) was diluted 1:75 in 2.5% horse serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... Coverslips were mounted using Glycergel (DAKO, C056330-2) preheated to 60°C ...
-
bioRxiv - Genomics 2022Quote: ... the Dako Bluing Buffer (Agilent Technologies, CS70230-2) was removed from each well and then each well washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Genomics 2022Quote: ... 75µL of Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was added to each tissue section well ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM glutamine (Agilent, Santa Clara, CA). The plate was incubated in a 37°C non-CO2 incubator for 1h prior to measurement ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2% proteinase K (Dako Omnis) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine solution (cat 103579-100) (Agilent). Neuron cultures were transferred to a non-CO2 incubator for 1 hour prior to running the assay ...
-
bioRxiv - Genomics 2024Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4×2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Physiology 2024Quote: ... and 2 mM L-Glutamine (Agilent #103579-100), and incubated at 26°C in a CO2-free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and mounted with mounting medium (S302380-2, Dako) on microscope slides.
-
bioRxiv - Neuroscience 2024Quote: ... total tau (Agilent Technologies, A002401-2, CA, USA), PHF1 (kindly gift from late Dr ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD68 (clone KP1; 1:100; M087629-2, DAKO), and Ki67 (clone SP6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD4 (clone 4B12; 1:50; M731001-2, DAKO), FOXP3 (clone D2W8E ...
-
bioRxiv - Neuroscience 2024Quote: ... or Dako EnVision Flex hemotoxylin (K800821-2, Dako). Slides were dehydrated in an ascending ethanol series and cleared in xylene before cover slipping with Cytoseal 60 (22-244-256 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM Glutamine (Agilent Technologies, 103579-100). HDLECs were maintained for 1 hour in a CO2-free incubator at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100β (1:1000, Agilent, GA50461-2), chicken anti-NF200 (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 2 times with 200 μL of extracellular flux assay medium (DMEM with 25 mM glucose, 2 mM sodium pyruvate, and 2 mM L-glutamine for mitochondrial stress test (Agilent Technologies). Assay medium was then added to each well to make the final well volume 180 uL ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 2 x 15 min in PBST and 2 x 15 min in PBS and coverslipped with Fluorescence Mounting Medium (DAKO #S3023).
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...