Labshake search
Citations for Agilent :
251 - 300 of 4538 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... 10-20 µl injection volume depending on protein concentration) were injected on a Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) at a flow rate of 100 µl/min using solvent A (0.1% formic acid and 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Systems Biology 2021Quote: ... using an Aminex HPX-87H ion-exchange column operated at 60°C with 5 mM H2SO4 as the mobile phase with a flow rate of 0.6 mL min-1 (Agilent, Santa Clara). The OD660 was measured with a Jenway 7200 spectrophotometer (Jenway ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Immunology 2021Quote: ... sections were washed three times in 1 X PBS for 5 minutes and the sections allowed to dry slightly before mounting with DAKO mounting medium (Agilent Technologies) and allowing to airdry overnight in the dark at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Immunology 2024Quote: ... followed by three washes for 5 minutes each with PBS + 1% BSA at RT before mounting with DAKO fluorescent mounting medium (Agilent S3023) and imaging ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN to 100:0 in 5 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 50 X 4.6 mm; Agilent Technologies, Inc). Method B ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN from 0:100 to 90:10 in 5 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 150 X 4.6 mm; Agilent Technologies, Inc). Method C ...
-
bioRxiv - Cancer Biology 2024Quote: ... then triethylammonium phosphate monobasic solution - CH3CN from 20:80 to 80:20 in 10 min with a flow rate of 1 mL/min (Column: Zorbax SB-Aq 5 µm analytical column, 150 X 4.6 mm; Agilent Technologies, Inc). Peaks were detected by UV absorption (210 nm ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (NeuN, 1:20,000, Millipore, MAB377B; CD68, 1:1,000, Serotec, MCA1957S; GFAP, 1:10,000, Dako Z0334) were diluted in 0.3% Triton X in PBS and incubated for 12 hours at RT ...
-
bioRxiv - Plant Biology 2020Quote: ... The digest was filtered (0.22 μm) and filtered samples (1-2 μg) were loaded onto a C18 high capacity nano LC chip (Agilent Technologies) using a 1200 series capillary and eluted directly into a 6550 series quadrupole time-of-flight mass spectrometer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... We used additional microglial markers including mouse anti-MHC-II/HLA-DP/DQ/DR (1:250, M077501-2, Agilent, UK), rabbit anti-PU.1 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Microbiology 2021Quote: Immunofluorescent (IF) staining was performed using the following primary antibodies: polyclonal rabbit anti-HSV-1 (cross-reactive with HSV-2; Agilent), anti-Iba1 (Wako ...
-
bioRxiv - Neuroscience 2020Quote: Total lysate and synaptoneurosomes isolated from cortex tissue of 1-month-old C57Bl/6 mice were UV crosslinked (100 mJ/cm2 for 2 cycles) using UV Stratalinker 2400 (Stratagene) and stored at −80°C until use ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Immunology 2023Quote: ... Cellular sphingolipids were analyzed after extraction with methanol:chloroform (2:1) using a 1290 Infinity II HPLC coupled with a 6495C triple-quadrupole mass spectrometer (Agilent Technologies) as previously described (Naser et al. ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... The single and triple-site mutations were introduced into the pcDNA3.1 vector encoding SARS-CoV-2 wildtype or BA.1 Spike using QuickChange site-directed mutagenesis (Agilent 210519) according to the instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples were incubated for 2 h at 4℃ in a guinea pig anti-insulin antibody (1:200, A0564, Dako), a rabbit anti-somatostatin antibody (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then washed and re-suspended in HBSS with 2% FBS with 1 μg/ml propidium iodide before acquisition on a Novocyte Quanteon or Penteon (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... Membranes were washed three times with TBS/T before HRP-coupled secondary antibodies were applied 1:25000 in TBS and incubated for 2 h at RT (Polyclonal rabbit anti-mouse, Dako P0260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... CD21 (DAKO, 1:25, CD23 (Leica, CD23-1B12, 1:50), CD4 (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Ki67 (1:50, clone MIB-1, Dako, M7240), mouse anti-INSR (1:50 ...