Labshake search
Citations for Agilent :
251 - 300 of 3443 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PVDF membranes were blocked in 5 % nonfat dry milk diluted in Tris-buffered saline with 0.05 % Tween-20 for 1 h at room temperature and then incubated overnight at 4 °C with antibodies against FN (1:70000, rabbit anti-fibronectin, DAKO, Hamburg, Germany). After washing with TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Adapter dilution (1:4) and PCR amplification (26 cycles) were optimized in a pilot experiment using Bioanalyzer DNA1000 (Agilent, Sant Clara, USA) chips as a read out of library size and quantity ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: Substitutions of S amino acids were introduced using Quikchange Lightning Site-Directed Mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... AMP-derivatised fatty acids as [M+H]+ were aligned using Mass Profinder v10.0 (Agilent Technologies) with an RT tolerance of 0.5 min and MS1 tolerance of 10 ppm ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated overnight at 4°C with the respective primary antibodies: (i) polyclonal rabbit anti-GFAP (1:2000; Dako, Cat. No. Z0334); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Microbiology 2024Quote: ... Single amino acid mutants were created using the QuikChange II XL site directed mutagenesis kit (Agilent). Primers were designed to introduce mutations at Met68 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 30 mM ammonium acetate (NH4Ac) (aq) + 0.1% formic acid (FA) + 0.0015% InfinityLab Deactivator (Agilent Technologies, Inc.) in 1% MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... Filtered samples (0.22 nitrocellulose filter) were analyzed for glucose and acetate acid using HPLC (Agilent 1260) with a refractive index detector and with a reverse-phase column C18 (Waters ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...