Labshake search
Citations for Agilent :
2801 - 2850 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and also using the High Sensitivity DNA Kit (Agilent, 5067-4626) with an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Molecular Biology 2024Quote: ... using an RNA 6000 Nano kit (Agilent Technologies, cat# 5067-1511). Quality and integrity of extracellular RNA was evaluated by quality control PCR with a 1:10 diluted sample ...
-
bioRxiv - Genomics 2024Quote: ... or DNF-474 NGS fragment kit on a Fragment Analyzer (Agilent). Libraries were sequenced in single-end mode of 50 bp on an Illumina HiSeq 4000 on the GenomEast platform (https://www.igbmc.fr/en/plateforms-and-services/platforms/genomeast).
-
bioRxiv - Cell Biology 2024Quote: ... The Extracellular Flux Assay Kit oxygen probes (Agilent Technologies, 103792-100) were activated in XF calibrant buffer (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a SureSelect Human All Exome V6 capture kit (Agilent, USA) or SeqCap EZ MedExome Enrichment Kit (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed using an RNA Pico 6000 kit (Agilent) and a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Genomics 2024Quote: ... using the High Sensitivity DNA analysis kit (Agilent, Cat# 5067-4626). ChIP-seq libraries were sequenced 75 bp single-end using Illumina NextSeq500/550 sequencer ...
-
bioRxiv - Cell Biology 2020Quote: ... and pom1521-200-GFP (pKBB520) fusions were generated by amplifying sGFP from pJK19-1 using PCR with PfuUltra™ HF (Agilent, Inc. Santa Clara, CA) and primers that generated chimeric Pom152-sGFP PCR products for homologous recombination in yeast ...
-
bioRxiv - Plant Biology 2020Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as a control of positive interaction (C+) ...
-
bioRxiv - Biophysics 2021Quote: ... a tile system was created using the Quikchange Lightning Multi kit (Agilent), as reported earlier (Kozek et al. ...
-
bioRxiv - Biophysics 2020Quote: ... using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... staining was revealed using the IDetect Super strain HRP polymer kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and sizing was determined by Fragment Analyzer HS Small Fragment Kit (Agilent). A smear analysis was conducted in the range of 150 to 1000 bp ...
-
bioRxiv - Cell Biology 2020Quote: ... Site-directed mutagenesis was performed using Quikchange Lightning mutagenesis kit (Agilent Technologies) and pEGFP-c1 hsOCRL1 (wild-type ...
-
bioRxiv - Cell Biology 2020Quote: ... and Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the Low-Input QuickAmp kit (Agilent, Santa Clara, CA, USA). The resulting cRNA was purified using the Absolute RNA Nanoprep kit (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). Libraries were sequenced on a HiSeq 4000 (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared using the SureSelect XT Library Prep Kit (Agilent) following the manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). The libraries were sequenced on an Illumina MiSeq ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and analysis using the Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). High quality samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Systems Biology 2022Quote: ... Sample quality and concentration were assessed by bioanalyzer (High Sensitivity kit, Agilent) and Qubit (Thermofisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCDH15 108N mutations were generated using the QuikChange Lightning mutagenesis kit (Agilent) and mutant protein fragments were expressed and purified identically to the wild-type constructs ...
-
bioRxiv - Genomics 2020Quote: ... with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI) ...
-
bioRxiv - Genomics 2020Quote: ... and quality controlled using a Bioanalyser High Sensitivity DNA Analysis kit (Agilent). Twelve liver ATAC-seq libraries arising from 3 biological replicates x 4 time points (T1-T4 ...
-
bioRxiv - Biochemistry 2020Quote: ... were constructed via the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... samples were incubated with secondary HRP-conjugated antibody (from DAKO envision kit) for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mutagenesis was carried out using QuikChange Lightning Multi kit (Agilent cat#210515); sequence changes were confirmed by DNA sequencing (Retrogen Inc.) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mutagenesis was performed using the QuikChange Lightning site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: Samples were analyzed by bioanalyzer using DNA-1000 kit (Agilent #5067-1504). Concentration of each library was determined by integrating under the peak of approximately 225-275bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the RNA 6000 Nano Kit (Agilent Technologies; cat. no. 5067-1511).
-
bioRxiv - Genomics 2019Quote: ... RNA profiles were then checked by Bioanalyzer (Agilent RNA 6000 Nano kit) and 1ug of RNA from each condition was used for mRNA-seq ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2019Quote: ... using the Seahorse XF Cell Mito Stress test kit (Agilent, 103015-100). 150.000 peritoneal macrophages and 25.000 primary hepatocytes were plated per well respectively ...
-
bioRxiv - Physiology 2019Quote: ... Quality of RNA was assessed using a RNA nano Bioanalyzer kit (Agilent) using a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Bound primary antibody was detected with an immunoperoxidase kit (EnVision Plus; Dako). Negative controls without primary antibody were used for all samples to confirm specificity ...
-
bioRxiv - Cell Biology 2019Quote: ... while site directed mutagenesis was done using the QuickChange II kit (Agilent). Complex reconfigurations of vector backbones and all point mutations were subsequently verified using standard Sanger sequencing (Macrogen ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis was performed with the QuikChange site-directed mutagenesis kit II (Stratagene) and successful mutagenesis was confirmed by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was prepared using miRNA 1-st strand cDNA synthesis kit (Agilent). Mature miRNA sequence and Universal reverse primer (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Immunology 2021Quote: ... and quality checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode (2 x 75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... underwent antigen retrieval and were incubated with primary antibodies (KIT, DakoCytomation/Agilent; Ki-67 ...
-
bioRxiv - Biophysics 2020Quote: ... Polymerization interface mutants were generated using a QuikChange Lightning mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... METTL5 mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Library quantification was performed with an Agilent DNA 1000 Kit (Agilent, CA). Template preparation with the DNA library followed by Ion Spheres Particle (ISP ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutants were generated with Quikchange XL kit (Agilent Technologies, Santa Clara, CA) and verified by sequencing.