Labshake search
Citations for Agilent :
2801 - 2850 of 5718 citations for Rat Cystatin S CST4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Library quality was assessed with a BioAnalyzer 2100 using the High Sensitivity DNA kit (Agilent Technologies). The libraries were quantified using the Kapa Library Quantification Kit Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... All libraries were quantified with the Fragment Analyzer using the standard sensitivity NGS kit (Agilent Technologies) and pooled in equimolar concentrations and quantified with a Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using an RNA 6000 Nano kit (5067-1511, Agilent) on a 2100 Bioanalyzer from Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA integrity number (RIN) was assessed using RNA 6000 Nano Kit (Agilent, Cat# 5067-1511) on Agilent Bioanalyzer 2100 ...
-
bioRxiv - Plant Biology 2023Quote: ... and quality checked using the High Sensitivity DNA or RNA Kits for Fragment Analyzer (Agilent Technologies). Only RNA samples with a RQN above 7 were kept for further use ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Microbiology 2023Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was confirmed by using the Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). Four libraries were pooled for pair-end sequencing with 100 cycles on a S1 flow cell lane in an Illumina NovaSeq 6000 System (UCSF Center for Advanced Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA quality was assessed using Agilent RNA 6000 Nano Kit on Agilent 2100 Bioanalyzer (Agilent, USA), and samples with RNA integrity number ≥ 8.0 were used for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... libraries were visualized on an Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA kit (Agilent Technologies) and quantified using Qubit dsDNA HS DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The final amplified libraries were validated using the Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) and quantified using the Qubit dsDNA HS Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... and library size and quality was determined via Bioanalyzer (Agilent High Sensitivity DNA Kit, 5067-4626). Libraries were first sequenced on an Illumina MiSeq using the 300-cycle kit (v2 ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the RNA integrity number (RIN) was calculated using the RNA 6000 Nano Kit (Agilent #5067-1511). RIN scores ranged between 8.7-9.7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were analyzed for insert size distribution on a 2100 BioAnalyzer High Sensitivity kit (Agilent Technologies,) 4200 TapeStation D1000 ScreenTape assay (Agilent Technologies, ...
-
bioRxiv - Cell Biology 2023Quote: ... Point mutations on GST-dyn1xA-PRR were generated using the QuickChange site-directed mutagenesis kit (Stratagene) and were cloned into pGEX-6P-1 vector (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We measured RNA quality using the Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, United States) and quantity using the Quant-it RiboGreen RNA Assay Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was assessed using the RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513), and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A ...
-
bioRxiv - Molecular Biology 2023Quote: ... Full-length WDR5-K259A and WDR5-K259E mutants were generated by Site-Directed Mutagenesis Kit (Agilent). All proteins were expressed in the E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RIN score was determined using a Bioanalyzer RNA 6000 Nano kit (Agilent, cat.no 5067-1511) in combination with the Agilent Bioanalyzer software ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Neuroscience 2023Quote: ... and H486R) were then introduced into this construct by QuikChange® Site-Directed Mutagenesis Kit (Stratagene) using the corresponding primers (Primer List below ...
-
bioRxiv - Cancer Biology 2023Quote: ... and library size distribution was measured with Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent Technologies). Final DNA libraries sequencing was performed in Illumina NovaSeq 6000 platform using the NovaSeq 6000 S1 Reagent Kit 300 cycles (2 x 150 paired-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations were introduced by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... Quality of the RNA extraction was assessed using the 2100 Bioanalyzer (Agilent, RNA 6000 Nano Kit) and selecting samples with a RNA Integrity Number (RIN ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed recombinant RlmI mutations using a QuikChange Site-Directed Mutagenesis Kit (#200518, Agilent Technologies, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥ 7,7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... TFRC or 4-HNE was detected by using a Dako EnVision FLEX kit (Dako, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA integrity number (RIN) was determined with Agilent RNA 6000 Nano Kit (Agilent, Cat. # 5067-1511) for quality check and all samples were above 8.5.
-
bioRxiv - Biochemistry 2024Quote: ... Mutations were introduced to the p38 expression construct using the QuikChange site-directed mutagenesis kit (Agilent). pCDFDuet-MKK6-EE was a gift from Kevin Janes (Addgene plasmid # 82718 ...
-
bioRxiv - Immunology 2024Quote: ... OCRs and ECARs were measured using Seahorse XF Cell Mito Stress Test Kit (103015-100, Agilent) and Seahorse XF Glycolysis Stress Test Kit (103020-100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated by following the microprep RNA isolation protocol and kit by Agilent (CAT#: 400805). RNA concentration after elution was calculated using a nanodrop in ng/µL of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Amino acid substitutions and deletions were introduced with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions.
-
bioRxiv - Immunology 2024Quote: ... Total RNA size distribution was determined by RNA 6000 Pico Kit for 2100 Bioanalyzer systems (Agilent).
-
bioRxiv - Microbiology 2024Quote: ... and the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quality of DNA samples was analysed using the high sensitivity DNA kit (Agilent 5067-4626) in Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta samples was assessed by Agilent Bioanalyzer 2100 (Fig. S1C) with the Agilent RNA 6000 Nano Kit (Agilent, Cat. No. 5067-1511). Then total RNA (500 ng per sample ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and DNA quality was verified using a Bioanalyzer 2100 with high-sensitivity DNA kits (Agilent, Japan). Short-inserts of 150-bp paired-end libraries were prepared for each individual using a Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The construct cpSRP54(Q185R) was generated using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) with pETDuet1™-cpSRP54 (Bals et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and the size was determined using the TapeStation 4200 with a High Sensitivity D1000 kit (Agilent). All libraries were mixed into a single tube with equal molarity ...
-
bioRxiv - Cell Biology 2024Quote: ... and the High Sensitivity NGS Fragment 1-6000bp kit on a 48-channel Fragment Analyzer (Agilent), respectively ...
-
bioRxiv - Developmental Biology 2024Quote: The quality of purified chromatin was assessed using the Bioanalyzer High Sensitivity DNA Analysis kit (Agilent). Libraries were sequenced using the NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Neuroscience 2024Quote: RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was ≥8.7 ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transiently transfected using either MBS mammalian transfection kit (Agilent Technologies, Stratagene, La Jolla, CA) or Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and analyzed by using a High Sensitivity DNA Kit on a Bioanalyzer 2100 (Agilent, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies), verified by DNA sequencing and purified as for the wild-type protein.
-
bioRxiv - Cancer Biology 2021Quote: ... purified libraries were validated and quantified using an Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent, Cat#: 50674626) and a Qubit dsDNA High Sensitivity Quantitation Assay (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the size distribution was confirmed with High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies #5067-4626). Libraries were sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt following manufacturer’s instructions ...