Labshake search
Citations for Agilent :
2801 - 2850 of 8609 citations for Cyclic GMP cGMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis was performed using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Whole exome sequencing (WES) was performed using the Mouse All Exon kit (Agilent) for target capture followed by next-generation sequencing by Psomagen ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2024Quote: Protein variants were constructed using a QuikChange site-directed mutagenesis kit (Agilent, USA). The primer that introduced desired nucleotide changes was designed using QuikChange online tool (Table S3C ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were incubated with anti-tubulin (Thermo PA1-41331; dilution 1:250) and K9JA (Dako A0024; dilution 1:500) antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Immunology 2019Quote: ... incubated overnight at 4 °C with polyclonal guinea pig anti-insulin antibody (1:100 in 1% BSA in DPBS, DAKO) followed by 1 h room temperature incubation either with Alexa Fluor® 488 AffiniPure donkey anti-guinea pig or with DyLight™ 594 AffiniPure donkey anti-guinea pig secondary antibody (1:100 in 1% BSA in DPBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Briefly, Iba1 (Wako, 019-19741, 1:2,000) was used to visualize microglia/macrophages and anti-GFAP (Dako, Z0334, 1:15,000) was used to visualize astrocytes ...
-
bioRxiv - Cancer Biology 2020Quote: ... trifluoroacetamide containing 1% trimethylchlorosilane (Pierce, 20 μl, 1 hour, 37 °C) and analysed by GC-MS using a VF5 capillary column (Agilent, 30 m ...
-
bioRxiv - Microbiology 2020Quote: ... The blocked membrane was then probed with anti-HA (1:1000 dilution, CellSignalling) and rabbit anti-mouse P260 IgG conjugated with HRP (1:1000 dilution, DAKO). The antibody-stained membrane was then soaked with SuperSignal West Pico PLUS substrate (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleus staining was performed with DAPI 1 µg/mL for 1 min and coverslips were mounted on slides with fluorescent mounting medium (Dako). Cells were observed under a SP8 confocal laser-scanning microscope equipped with an HCP PL APO 100x/1.44 Oil CORR CS immersion objective (Leica) ...
-
bioRxiv - Neuroscience 2020Quote: ... Immunohistochemistry with polyclonal antibody 1175 (1:1,000) directed against α-synuclein phosphorylated at Ser129 or anti-ubiquitin (DAKO, 1:10,000) were performed as described previously (Masuda-Suzukake et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:100 or CD3 antibodies (Spring biosciences, Clone SP7, ref. M3070) diluted 1:200 in Antibody diluent solution (DakoCytomation). After several washes in PBS ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Molecular Biology 2020Quote: ... Goat polyclonal anti-mouse (p0447, bach number 20051789. 1/3000) and anti-rabbit (p0448, batch number 20017525. 1/5000) antibodies were purchased from Dako.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Polyclonal goat anti-rabbit (#P0448, dilution 1:5000) and polyclonal goat anti-mouse (#P0447, dilution 1:5000) secondary antibodies were obtained from Dako products (CA ...
-
bioRxiv - Biophysics 2020Quote: His-tagged CrSAS-6[NL] spanning amino acids 1-503 of the protein (see Supplementary Fig. 1a)1 was expressed in the Escherichia coli strain BL21(DE3) (Stratagene). Bacteria were grown at 37 °C in lysogeny broth (LB ...
-
bioRxiv - Cancer Biology 2020Quote: ... sections were blocked in DAB substrate-chromogen solution containing 1 ml substrate buffer and 1 drop of DAB chromogen (DAKO) for 10 minutes followed by rising with dH2O for 5 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... construct by deleting 14aa from near the C-terminus of PRC1 isoform 1 (aa:1-620) using Quikchange mutagenesis (Agilent). The PRC1 isoform 2 gene was then in a pET-DUET plasmid containing an N-terminal histidine tag followed by a Tobacco Etch Virus (TEV ...
-
bioRxiv - Cell Biology 2020Quote: ... then probed for 1 hr at room temperature with HRP-conjugated goat anti-mouse IgG secondary antibodies 1:500 in PBS (Dako, Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were blocked with 5% normal donkey serum for 1 h at room temperature and incubated with primary antibodies (rabbit anti-GFAP 1:200, Dako; goat anti-Iba1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 200 µl min-1 and the digested peptides were captured on a 2 mm x 1 cm C8 trap column (Agilent) and desalted ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Pu.1 (1:200; 2258, Cell Signalling), hamster anti-CD3 (1:500; MCA2690, AbD Serotec) or rabbit anti-GFAP (1:2400, Z0334, Dako) diluted in the blocking solution overnight at 4°C plus one additional hour at room temperature (RT) ...
-
bioRxiv - Immunology 2024Quote: ... The membrane was washed three times in block buffer followed by a 1 h incubation with anti-goat/-rabbit HRP-conjugated secondary antibodies (1:5000, Agilent Dako) at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...